ID: 1015812832

View in Genome Browser
Species Human (GRCh38)
Location 6:137178214-137178236
Sequence GAGTCTCCATAGGTCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015812825_1015812832 18 Left 1015812825 6:137178173-137178195 CCCAAACTTGCAAGCAGGAATCA No data
Right 1015812832 6:137178214-137178236 GAGTCTCCATAGGTCCCAGGAGG No data
1015812826_1015812832 17 Left 1015812826 6:137178174-137178196 CCAAACTTGCAAGCAGGAATCAA No data
Right 1015812832 6:137178214-137178236 GAGTCTCCATAGGTCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015812832 Original CRISPR GAGTCTCCATAGGTCCCAGG AGG Intergenic
No off target data available for this crispr