ID: 1015813717

View in Genome Browser
Species Human (GRCh38)
Location 6:137186352-137186374
Sequence TGTGCCTATGGCCATTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015813709_1015813717 29 Left 1015813709 6:137186300-137186322 CCAGGAGGGAAGGGGGAATGGGG No data
Right 1015813717 6:137186352-137186374 TGTGCCTATGGCCATTGGGTTGG No data
1015813711_1015813717 -6 Left 1015813711 6:137186335-137186357 CCTATCCATCCTACACATGTGCC No data
Right 1015813717 6:137186352-137186374 TGTGCCTATGGCCATTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015813717 Original CRISPR TGTGCCTATGGCCATTGGGT TGG Intergenic
No off target data available for this crispr