ID: 1015813780

View in Genome Browser
Species Human (GRCh38)
Location 6:137186773-137186795
Sequence GTCAAAGGAGTCGCCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015813780_1015813783 29 Left 1015813780 6:137186773-137186795 CCTTCTGGGGCGACTCCTTTGAC No data
Right 1015813783 6:137186825-137186847 ATTACCTCAACATTTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015813780 Original CRISPR GTCAAAGGAGTCGCCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr