ID: 1015815957

View in Genome Browser
Species Human (GRCh38)
Location 6:137211015-137211037
Sequence TTATTGCAGTGGTTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015815953_1015815957 -1 Left 1015815953 6:137210993-137211015 CCTTTTCTGATTATTTTTTCCTT 0: 1
1: 0
2: 15
3: 225
4: 2284
Right 1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG No data
1015815952_1015815957 12 Left 1015815952 6:137210980-137211002 CCATTATTATTTTCCTTTTCTGA 0: 1
1: 2
2: 15
3: 165
4: 1731
Right 1015815957 6:137211015-137211037 TTATTGCAGTGGTTCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015815957 Original CRISPR TTATTGCAGTGGTTCTCTGT GGG Intronic
No off target data available for this crispr