ID: 1015816896

View in Genome Browser
Species Human (GRCh38)
Location 6:137219959-137219981
Sequence GTCTGCTCTCTTACCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015816894_1015816896 -9 Left 1015816894 6:137219945-137219967 CCTCTCATGAAGAGGTCTGCTCT No data
Right 1015816896 6:137219959-137219981 GTCTGCTCTCTTACCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015816896 Original CRISPR GTCTGCTCTCTTACCTCTCT GGG Intergenic
No off target data available for this crispr