ID: 1015827162

View in Genome Browser
Species Human (GRCh38)
Location 6:137326362-137326384
Sequence TCTCCCATGGAACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015827162_1015827165 16 Left 1015827162 6:137326362-137326384 CCAGCTTGTGGTTCCATGGGAGA No data
Right 1015827165 6:137326401-137326423 TCTCATATAATCTTTCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015827162 Original CRISPR TCTCCCATGGAACCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr