ID: 1015827860

View in Genome Browser
Species Human (GRCh38)
Location 6:137335081-137335103
Sequence CTGGAATGGAAGGAGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015827848_1015827860 27 Left 1015827848 6:137335031-137335053 CCAGCATGGCATGTGCATGTGCA No data
Right 1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG No data
1015827847_1015827860 28 Left 1015827847 6:137335030-137335052 CCCAGCATGGCATGTGCATGTGC No data
Right 1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG No data
1015827846_1015827860 29 Left 1015827846 6:137335029-137335051 CCCCAGCATGGCATGTGCATGTG No data
Right 1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG No data
1015827855_1015827860 -10 Left 1015827855 6:137335068-137335090 CCAGGCCCTCATGCTGGAATGGA No data
Right 1015827860 6:137335081-137335103 CTGGAATGGAAGGAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015827860 Original CRISPR CTGGAATGGAAGGAGGTGCC TGG Intergenic
No off target data available for this crispr