ID: 1015828990

View in Genome Browser
Species Human (GRCh38)
Location 6:137347009-137347031
Sequence CAACCCTGCCTCAAAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015828985_1015828990 -4 Left 1015828985 6:137346990-137347012 CCTTTGGGAGCCCCTGTACCAAC No data
Right 1015828990 6:137347009-137347031 CAACCCTGCCTCAAAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015828990 Original CRISPR CAACCCTGCCTCAAAAAGAA AGG Intergenic
No off target data available for this crispr