ID: 1015831322

View in Genome Browser
Species Human (GRCh38)
Location 6:137372191-137372213
Sequence GTTTGGAATAAATGAAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015831322_1015831327 25 Left 1015831322 6:137372191-137372213 CCATTGCTTCATTTATTCCAAAC No data
Right 1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015831322 Original CRISPR GTTTGGAATAAATGAAGCAA TGG (reversed) Intergenic
No off target data available for this crispr