ID: 1015831325

View in Genome Browser
Species Human (GRCh38)
Location 6:137372213-137372235
Sequence TTGTTAGGTTGCTTTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015831325_1015831327 3 Left 1015831325 6:137372213-137372235 CCATGGAAAAAGCAACCTAACAA No data
Right 1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015831325 Original CRISPR TTGTTAGGTTGCTTTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr