ID: 1015831327

View in Genome Browser
Species Human (GRCh38)
Location 6:137372239-137372261
Sequence ATGCCCATCTAGAATACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015831325_1015831327 3 Left 1015831325 6:137372213-137372235 CCATGGAAAAAGCAACCTAACAA No data
Right 1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG No data
1015831324_1015831327 8 Left 1015831324 6:137372208-137372230 CCAAACCATGGAAAAAGCAACCT No data
Right 1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG No data
1015831322_1015831327 25 Left 1015831322 6:137372191-137372213 CCATTGCTTCATTTATTCCAAAC No data
Right 1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015831327 Original CRISPR ATGCCCATCTAGAATACTGA AGG Intergenic
No off target data available for this crispr