ID: 1015831830

View in Genome Browser
Species Human (GRCh38)
Location 6:137378094-137378116
Sequence AGTTATTCACAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015831827_1015831830 23 Left 1015831827 6:137378048-137378070 CCAAACAGTCACATGGTGGAAGA No data
Right 1015831830 6:137378094-137378116 AGTTATTCACAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015831830 Original CRISPR AGTTATTCACAGAAAATGGA AGG Intergenic
No off target data available for this crispr