ID: 1015834124

View in Genome Browser
Species Human (GRCh38)
Location 6:137401118-137401140
Sequence TAGAATGTGCATCTTGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015834124_1015834126 -8 Left 1015834124 6:137401118-137401140 CCTTATTCAAGATGCACATTCTA No data
Right 1015834126 6:137401133-137401155 ACATTCTAGGCTTTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015834124 Original CRISPR TAGAATGTGCATCTTGAATA AGG (reversed) Intergenic
No off target data available for this crispr