ID: 1015834535

View in Genome Browser
Species Human (GRCh38)
Location 6:137405884-137405906
Sequence ATGCTATTTGCTTCTCTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015834535_1015834538 6 Left 1015834535 6:137405884-137405906 CCCCTAAGAGAAGCAAATAGCAT No data
Right 1015834538 6:137405913-137405935 ATCTCTCAAGCACACAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015834535 Original CRISPR ATGCTATTTGCTTCTCTTAG GGG (reversed) Intergenic