ID: 1015835634

View in Genome Browser
Species Human (GRCh38)
Location 6:137417251-137417273
Sequence CTGGCCTTCCACCCTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015835634_1015835638 -1 Left 1015835634 6:137417251-137417273 CCTGAATCAGGGTGGAAGGCCAG No data
Right 1015835638 6:137417273-137417295 GGACAAGGAAGAGCATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015835634 Original CRISPR CTGGCCTTCCACCCTGATTC AGG (reversed) Intergenic
No off target data available for this crispr