ID: 1015835638

View in Genome Browser
Species Human (GRCh38)
Location 6:137417273-137417295
Sequence GGACAAGGAAGAGCATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015835629_1015835638 13 Left 1015835629 6:137417237-137417259 CCGAGGGGAATCAGCCTGAATCA No data
Right 1015835638 6:137417273-137417295 GGACAAGGAAGAGCATCTCTAGG No data
1015835628_1015835638 14 Left 1015835628 6:137417236-137417258 CCCGAGGGGAATCAGCCTGAATC No data
Right 1015835638 6:137417273-137417295 GGACAAGGAAGAGCATCTCTAGG No data
1015835627_1015835638 15 Left 1015835627 6:137417235-137417257 CCCCGAGGGGAATCAGCCTGAAT No data
Right 1015835638 6:137417273-137417295 GGACAAGGAAGAGCATCTCTAGG No data
1015835634_1015835638 -1 Left 1015835634 6:137417251-137417273 CCTGAATCAGGGTGGAAGGCCAG No data
Right 1015835638 6:137417273-137417295 GGACAAGGAAGAGCATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015835638 Original CRISPR GGACAAGGAAGAGCATCTCT AGG Intergenic
No off target data available for this crispr