ID: 1015839274

View in Genome Browser
Species Human (GRCh38)
Location 6:137459608-137459630
Sequence CCCCTCAGGGGGTACCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015839274_1015839280 12 Left 1015839274 6:137459608-137459630 CCTGATGGGTACCCCCTGAGGGG No data
Right 1015839280 6:137459643-137459665 AATTGAGATTTTAGAGAATGAGG No data
1015839274_1015839281 13 Left 1015839274 6:137459608-137459630 CCTGATGGGTACCCCCTGAGGGG No data
Right 1015839281 6:137459644-137459666 ATTGAGATTTTAGAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015839274 Original CRISPR CCCCTCAGGGGGTACCCATC AGG (reversed) Intergenic