ID: 1015842047

View in Genome Browser
Species Human (GRCh38)
Location 6:137487605-137487627
Sequence CTGAATAACCAGGAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015842035_1015842047 19 Left 1015842035 6:137487563-137487585 CCTTTCCCGGAGTAGACGGAAGG No data
Right 1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG No data
1015842040_1015842047 13 Left 1015842040 6:137487569-137487591 CCGGAGTAGACGGAAGGGAGGCG No data
Right 1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG No data
1015842033_1015842047 25 Left 1015842033 6:137487557-137487579 CCTTGTCCTTTCCCGGAGTAGAC No data
Right 1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG No data
1015842039_1015842047 14 Left 1015842039 6:137487568-137487590 CCCGGAGTAGACGGAAGGGAGGC No data
Right 1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015842047 Original CRISPR CTGAATAACCAGGAGGAGAA AGG Intergenic
No off target data available for this crispr