ID: 1015843136

View in Genome Browser
Species Human (GRCh38)
Location 6:137493978-137494000
Sequence GCGGGCTGGCGCCAAGGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015843136_1015843147 23 Left 1015843136 6:137493978-137494000 CCGCGGCCTTGGCGCCAGCCCGC 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1015843147 6:137494024-137494046 CTGCATCATATCGCCCTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 64
1015843136_1015843141 -6 Left 1015843136 6:137493978-137494000 CCGCGGCCTTGGCGCCAGCCCGC 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1015843141 6:137493995-137494017 GCCCGCGAGAGGCTTTCCCCGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1015843136_1015843140 -7 Left 1015843136 6:137493978-137494000 CCGCGGCCTTGGCGCCAGCCCGC 0: 1
1: 0
2: 1
3: 22
4: 260
Right 1015843140 6:137493994-137494016 AGCCCGCGAGAGGCTTTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015843136 Original CRISPR GCGGGCTGGCGCCAAGGCCG CGG (reversed) Exonic