ID: 1015849957

View in Genome Browser
Species Human (GRCh38)
Location 6:137561163-137561185
Sequence TTAAAGATATATATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015849957_1015849960 6 Left 1015849957 6:137561163-137561185 CCTCCCTCAATATATATCTTTAA No data
Right 1015849960 6:137561192-137561214 TTCAATACTTCTAGATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015849957 Original CRISPR TTAAAGATATATATTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr