ID: 1015849960

View in Genome Browser
Species Human (GRCh38)
Location 6:137561192-137561214
Sequence TTCAATACTTCTAGATAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015849957_1015849960 6 Left 1015849957 6:137561163-137561185 CCTCCCTCAATATATATCTTTAA No data
Right 1015849960 6:137561192-137561214 TTCAATACTTCTAGATAAAATGG No data
1015849958_1015849960 3 Left 1015849958 6:137561166-137561188 CCCTCAATATATATCTTTAATTA No data
Right 1015849960 6:137561192-137561214 TTCAATACTTCTAGATAAAATGG No data
1015849956_1015849960 7 Left 1015849956 6:137561162-137561184 CCCTCCCTCAATATATATCTTTA No data
Right 1015849960 6:137561192-137561214 TTCAATACTTCTAGATAAAATGG No data
1015849959_1015849960 2 Left 1015849959 6:137561167-137561189 CCTCAATATATATCTTTAATTAA No data
Right 1015849960 6:137561192-137561214 TTCAATACTTCTAGATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015849960 Original CRISPR TTCAATACTTCTAGATAAAA TGG Intergenic
No off target data available for this crispr