ID: 1015851589

View in Genome Browser
Species Human (GRCh38)
Location 6:137579359-137579381
Sequence GAGTGTGAGCCTATAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015851588_1015851589 10 Left 1015851588 6:137579326-137579348 CCTTAATGATGAGTAAGGTAGAG No data
Right 1015851589 6:137579359-137579381 GAGTGTGAGCCTATAGCATATGG No data
1015851586_1015851589 20 Left 1015851586 6:137579316-137579338 CCAAAAGCATCCTTAATGATGAG No data
Right 1015851589 6:137579359-137579381 GAGTGTGAGCCTATAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015851589 Original CRISPR GAGTGTGAGCCTATAGCATA TGG Intergenic
No off target data available for this crispr