ID: 1015854638

View in Genome Browser
Species Human (GRCh38)
Location 6:137610264-137610286
Sequence TGCTGGGAGTTGAGGGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015854627_1015854638 -7 Left 1015854627 6:137610248-137610270 CCCCTCCACATTGCCCTGCTGGG No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data
1015854623_1015854638 21 Left 1015854623 6:137610220-137610242 CCTACTGCATGTGCTCCATTTAC No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data
1015854624_1015854638 6 Left 1015854624 6:137610235-137610257 CCATTTACCTGAGCCCCTCCACA No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data
1015854625_1015854638 -1 Left 1015854625 6:137610242-137610264 CCTGAGCCCCTCCACATTGCCCT No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data
1015854630_1015854638 -9 Left 1015854630 6:137610250-137610272 CCTCCACATTGCCCTGCTGGGAG No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data
1015854629_1015854638 -8 Left 1015854629 6:137610249-137610271 CCCTCCACATTGCCCTGCTGGGA No data
Right 1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015854638 Original CRISPR TGCTGGGAGTTGAGGGCAAG GGG Intergenic
No off target data available for this crispr