ID: 1015861825

View in Genome Browser
Species Human (GRCh38)
Location 6:137689467-137689489
Sequence TTATATGTGCAAAATTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015861823_1015861825 -3 Left 1015861823 6:137689447-137689469 CCTACGAAACAAGGAAATATTTA No data
Right 1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG No data
1015861821_1015861825 21 Left 1015861821 6:137689423-137689445 CCTTCATTTGTGATGGTCAGAAT No data
Right 1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015861825 Original CRISPR TTATATGTGCAAAATTTGGA AGG Intergenic
No off target data available for this crispr