ID: 1015862089

View in Genome Browser
Species Human (GRCh38)
Location 6:137691813-137691835
Sequence AGTTATCTGTGGATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015862089_1015862095 16 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862095 6:137691852-137691874 ACAGCTTTTGGCCTGCTCCTGGG No data
1015862089_1015862094 15 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862094 6:137691851-137691873 GACAGCTTTTGGCCTGCTCCTGG No data
1015862089_1015862097 30 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862097 6:137691866-137691888 GCTCCTGGGCCTTGTGCAAATGG No data
1015862089_1015862092 4 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862092 6:137691840-137691862 TCCTTTTAAGAGACAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015862089 Original CRISPR AGTTATCTGTGGATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr