ID: 1015862095

View in Genome Browser
Species Human (GRCh38)
Location 6:137691852-137691874
Sequence ACAGCTTTTGGCCTGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015862090_1015862095 12 Left 1015862090 6:137691817-137691839 CCATCATCCACAGATAACTACTC No data
Right 1015862095 6:137691852-137691874 ACAGCTTTTGGCCTGCTCCTGGG No data
1015862089_1015862095 16 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862095 6:137691852-137691874 ACAGCTTTTGGCCTGCTCCTGGG No data
1015862091_1015862095 5 Left 1015862091 6:137691824-137691846 CCACAGATAACTACTCTCCTTTT No data
Right 1015862095 6:137691852-137691874 ACAGCTTTTGGCCTGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015862095 Original CRISPR ACAGCTTTTGGCCTGCTCCT GGG Intergenic
No off target data available for this crispr