ID: 1015862097

View in Genome Browser
Species Human (GRCh38)
Location 6:137691866-137691888
Sequence GCTCCTGGGCCTTGTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015862089_1015862097 30 Left 1015862089 6:137691813-137691835 CCTGCCATCATCCACAGATAACT No data
Right 1015862097 6:137691866-137691888 GCTCCTGGGCCTTGTGCAAATGG No data
1015862091_1015862097 19 Left 1015862091 6:137691824-137691846 CCACAGATAACTACTCTCCTTTT No data
Right 1015862097 6:137691866-137691888 GCTCCTGGGCCTTGTGCAAATGG No data
1015862090_1015862097 26 Left 1015862090 6:137691817-137691839 CCATCATCCACAGATAACTACTC No data
Right 1015862097 6:137691866-137691888 GCTCCTGGGCCTTGTGCAAATGG No data
1015862093_1015862097 2 Left 1015862093 6:137691841-137691863 CCTTTTAAGAGACAGCTTTTGGC No data
Right 1015862097 6:137691866-137691888 GCTCCTGGGCCTTGTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015862097 Original CRISPR GCTCCTGGGCCTTGTGCAAA TGG Intergenic
No off target data available for this crispr