ID: 1015863018

View in Genome Browser
Species Human (GRCh38)
Location 6:137700132-137700154
Sequence GGGAGTAAACAGCAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015863011_1015863018 29 Left 1015863011 6:137700080-137700102 CCTCCTATCAGGAATCATGCTCA No data
Right 1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG No data
1015863012_1015863018 26 Left 1015863012 6:137700083-137700105 CCTATCAGGAATCATGCTCAAGT No data
Right 1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG No data
1015863013_1015863018 2 Left 1015863013 6:137700107-137700129 CCAATTCAATTTCAATGAGAGAT No data
Right 1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015863018 Original CRISPR GGGAGTAAACAGCAGGAAGG AGG Intergenic
No off target data available for this crispr