ID: 1015864254

View in Genome Browser
Species Human (GRCh38)
Location 6:137711713-137711735
Sequence ATGACCACGTGGAGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015864246_1015864254 11 Left 1015864246 6:137711679-137711701 CCTGGCCAGCTCCAGCAACAGGA No data
Right 1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG No data
1015864248_1015864254 6 Left 1015864248 6:137711684-137711706 CCAGCTCCAGCAACAGGAAGGAG No data
Right 1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG No data
1015864250_1015864254 0 Left 1015864250 6:137711690-137711712 CCAGCAACAGGAAGGAGGCCAGT No data
Right 1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG No data
1015864244_1015864254 22 Left 1015864244 6:137711668-137711690 CCATGAGTTTGCCTGGCCAGCTC No data
Right 1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015864254 Original CRISPR ATGACCACGTGGAGTGAGCA GGG Intergenic
No off target data available for this crispr