ID: 1015870216

View in Genome Browser
Species Human (GRCh38)
Location 6:137768760-137768782
Sequence ACAGCTAATACGTGGTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015870214_1015870216 8 Left 1015870214 6:137768729-137768751 CCTAGGGAGGCAAAGTGACTTCT No data
Right 1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG No data
1015870213_1015870216 11 Left 1015870213 6:137768726-137768748 CCACCTAGGGAGGCAAAGTGACT No data
Right 1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015870216 Original CRISPR ACAGCTAATACGTGGTGAAT AGG Intergenic
No off target data available for this crispr