ID: 1015870602

View in Genome Browser
Species Human (GRCh38)
Location 6:137772694-137772716
Sequence TGCATCCCAGAGGTGCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015870602_1015870604 -8 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870604 6:137772709-137772731 GGGATGCAGCCACGTCAGCGTGG No data
1015870602_1015870610 20 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870610 6:137772737-137772759 GAGCCACAGACCCGCATTGGGGG No data
1015870602_1015870607 17 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data
1015870602_1015870608 18 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870608 6:137772735-137772757 AGGAGCCACAGACCCGCATTGGG No data
1015870602_1015870612 23 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870612 6:137772740-137772762 CCACAGACCCGCATTGGGGGAGG No data
1015870602_1015870605 -2 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870605 6:137772715-137772737 CAGCCACGTCAGCGTGGAGAAGG No data
1015870602_1015870613 24 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870613 6:137772741-137772763 CACAGACCCGCATTGGGGGAGGG No data
1015870602_1015870615 30 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870615 6:137772747-137772769 CCCGCATTGGGGGAGGGCAGTGG No data
1015870602_1015870609 19 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870609 6:137772736-137772758 GGAGCCACAGACCCGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015870602 Original CRISPR TGCATCCCAGAGGTGCTGTT AGG (reversed) Intergenic
No off target data available for this crispr