ID: 1015870603

View in Genome Browser
Species Human (GRCh38)
Location 6:137772704-137772726
Sequence CTGACGTGGCTGCATCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015870603_1015870615 20 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870615 6:137772747-137772769 CCCGCATTGGGGGAGGGCAGTGG No data
1015870603_1015870613 14 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870613 6:137772741-137772763 CACAGACCCGCATTGGGGGAGGG No data
1015870603_1015870610 10 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870610 6:137772737-137772759 GAGCCACAGACCCGCATTGGGGG No data
1015870603_1015870608 8 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870608 6:137772735-137772757 AGGAGCCACAGACCCGCATTGGG No data
1015870603_1015870609 9 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870609 6:137772736-137772758 GGAGCCACAGACCCGCATTGGGG No data
1015870603_1015870612 13 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870612 6:137772740-137772762 CCACAGACCCGCATTGGGGGAGG No data
1015870603_1015870607 7 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015870603 Original CRISPR CTGACGTGGCTGCATCCCAG AGG (reversed) Intergenic
No off target data available for this crispr