ID: 1015870607

View in Genome Browser
Species Human (GRCh38)
Location 6:137772734-137772756
Sequence AAGGAGCCACAGACCCGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015870602_1015870607 17 Left 1015870602 6:137772694-137772716 CCTAACAGCACCTCTGGGATGCA No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data
1015870606_1015870607 -7 Left 1015870606 6:137772718-137772740 CCACGTCAGCGTGGAGAAGGAGC No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data
1015870600_1015870607 22 Left 1015870600 6:137772689-137772711 CCGGGCCTAACAGCACCTCTGGG No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data
1015870603_1015870607 7 Left 1015870603 6:137772704-137772726 CCTCTGGGATGCAGCCACGTCAG No data
Right 1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015870607 Original CRISPR AAGGAGCCACAGACCCGCAT TGG Intergenic
No off target data available for this crispr