ID: 1015885730

View in Genome Browser
Species Human (GRCh38)
Location 6:137916109-137916131
Sequence GAGACAGAGACCCTCTGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015885730_1015885734 8 Left 1015885730 6:137916109-137916131 CCGTATCAGAGGGTCTCTGTCTC No data
Right 1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG No data
1015885730_1015885731 1 Left 1015885730 6:137916109-137916131 CCGTATCAGAGGGTCTCTGTCTC No data
Right 1015885731 6:137916133-137916155 TTCCAGATAAAATAAATAGAAGG No data
1015885730_1015885733 4 Left 1015885730 6:137916109-137916131 CCGTATCAGAGGGTCTCTGTCTC No data
Right 1015885733 6:137916136-137916158 CAGATAAAATAAATAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015885730 Original CRISPR GAGACAGAGACCCTCTGATA CGG (reversed) Intergenic
No off target data available for this crispr