ID: 1015885734

View in Genome Browser
Species Human (GRCh38)
Location 6:137916140-137916162
Sequence TAAAATAAATAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015885730_1015885734 8 Left 1015885730 6:137916109-137916131 CCGTATCAGAGGGTCTCTGTCTC No data
Right 1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG No data
1015885729_1015885734 12 Left 1015885729 6:137916105-137916127 CCAACCGTATCAGAGGGTCTCTG No data
Right 1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015885734 Original CRISPR TAAAATAAATAGAAGGAGGC AGG Intergenic
No off target data available for this crispr