ID: 1015887543

View in Genome Browser
Species Human (GRCh38)
Location 6:137933775-137933797
Sequence ATTGAGAAGCCAAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015887543_1015887547 26 Left 1015887543 6:137933775-137933797 CCTTCCTATTTTGGCTTCTCAAT No data
Right 1015887547 6:137933824-137933846 GTTTCACTGAGTCATGAACTGGG No data
1015887543_1015887546 25 Left 1015887543 6:137933775-137933797 CCTTCCTATTTTGGCTTCTCAAT No data
Right 1015887546 6:137933823-137933845 CGTTTCACTGAGTCATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015887543 Original CRISPR ATTGAGAAGCCAAAATAGGA AGG (reversed) Intergenic
No off target data available for this crispr