ID: 1015887543 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:137933775-137933797 |
| Sequence | ATTGAGAAGCCAAAATAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1015887543_1015887547 | 26 | Left | 1015887543 | 6:137933775-137933797 | CCTTCCTATTTTGGCTTCTCAAT | No data | ||
| Right | 1015887547 | 6:137933824-137933846 | GTTTCACTGAGTCATGAACTGGG | No data | ||||
| 1015887543_1015887546 | 25 | Left | 1015887543 | 6:137933775-137933797 | CCTTCCTATTTTGGCTTCTCAAT | No data | ||
| Right | 1015887546 | 6:137933823-137933845 | CGTTTCACTGAGTCATGAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1015887543 | Original CRISPR | ATTGAGAAGCCAAAATAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||