ID: 1015898089

View in Genome Browser
Species Human (GRCh38)
Location 6:138036243-138036265
Sequence CTGGAGGCCTAGGAGTATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015898089_1015898096 15 Left 1015898089 6:138036243-138036265 CCGTCATACTCCTAGGCCTCCAG No data
Right 1015898096 6:138036281-138036303 GCCTTCCTGAGTCATTGTGAGGG No data
1015898089_1015898100 29 Left 1015898089 6:138036243-138036265 CCGTCATACTCCTAGGCCTCCAG No data
Right 1015898100 6:138036295-138036317 TTGTGAGGGTGTGGCCCGTGTGG No data
1015898089_1015898095 14 Left 1015898089 6:138036243-138036265 CCGTCATACTCCTAGGCCTCCAG No data
Right 1015898095 6:138036280-138036302 AGCCTTCCTGAGTCATTGTGAGG No data
1015898089_1015898099 20 Left 1015898089 6:138036243-138036265 CCGTCATACTCCTAGGCCTCCAG No data
Right 1015898099 6:138036286-138036308 CCTGAGTCATTGTGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015898089 Original CRISPR CTGGAGGCCTAGGAGTATGA CGG (reversed) Intergenic
No off target data available for this crispr