ID: 1015903391

View in Genome Browser
Species Human (GRCh38)
Location 6:138090633-138090655
Sequence TTGGACACCTAAAATGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015903390_1015903391 -6 Left 1015903390 6:138090616-138090638 CCACTCAAAAATTGGTTTTGGAC 0: 1
1: 1
2: 1
3: 13
4: 171
Right 1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG 0: 1
1: 0
2: 4
3: 93
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015903391 Original CRISPR TTGGACACCTAAAATGAGCA AGG Exonic
902266876 1:15273550-15273572 TTGTACGCTTAAAATGGGCAGGG - Intronic
903375351 1:22862350-22862372 TTGGGCACCTATACTGTGCAAGG + Intronic
906923754 1:50092216-50092238 TTGGAAACACAAAAAGAGCATGG + Intronic
907111088 1:51927179-51927201 TTGAGCACCTAAAATAAGCAAGG + Intronic
907660414 1:56387299-56387321 TTGAACACCTAAAATCATCTGGG + Intergenic
908652642 1:66352750-66352772 TTGAATACCTAAAATGACCAGGG - Intronic
909948148 1:81687461-81687483 ATGGACACCAAAAGTGAGCAGGG - Intronic
910160271 1:84264975-84264997 TTAGACAGCTAATATGTGCAGGG + Intergenic
910738782 1:90492807-90492829 ATGGACACCAAAAGTCAGCAGGG - Intergenic
911505239 1:98740987-98741009 TTGGAGCCCTTAAATGATCAGGG + Intronic
911678704 1:100689862-100689884 ATGGACACCAAAAGCGAGCAGGG - Intergenic
911689342 1:100814328-100814350 ATGGACACCAAAAGTGAGTAGGG + Intergenic
911694359 1:100871811-100871833 CTGAACATCTAAAATGGGCAAGG + Intergenic
912176972 1:107171323-107171345 ATGGACATGGAAAATGAGCAAGG - Intronic
912615948 1:111100268-111100290 AAGGACACCAAAAGTGAGCAGGG - Intergenic
913151562 1:116048922-116048944 ATGGACACAAAAAGTGAGCAGGG + Intronic
913463944 1:119119242-119119264 ATGGACACCAAAAGTGAGCAGGG + Intronic
914346267 1:146801322-146801344 ATGGACACCAAAAGAGAGCAGGG + Intergenic
914455281 1:147830990-147831012 ATGGACACCAAAAGTGAGCAGGG - Intergenic
916812063 1:168314384-168314406 TTGGGCACCTACAATAGGCAAGG - Exonic
916870666 1:168911340-168911362 TTGAACATGTAAAATGAGCCAGG + Intergenic
917319191 1:173761055-173761077 ATGGACACCAAAAGCGAGCAGGG + Intronic
917898265 1:179514883-179514905 ATGGACACCAAAAGCGAGCAGGG - Intronic
920726763 1:208443549-208443571 ATGGACACCAAAAGTAAGCAGGG - Intergenic
921834717 1:219766054-219766076 ATGGACACCAAAAGTGAGCAGGG + Intronic
922658078 1:227403043-227403065 ATGGACACCAAAAGTGAGCAGGG + Intergenic
922927159 1:229359233-229359255 ATGGACACCAAAAGCGAGCAGGG - Intergenic
923944573 1:238869701-238869723 TGGGACAGCTAAAATAAGTAAGG + Intergenic
924061067 1:240174857-240174879 TTGGACACTTAAAATGGTTAAGG - Intronic
1062830342 10:601344-601366 TTGGACATCTAAAATGGGAATGG - Intronic
1063867300 10:10379745-10379767 ATGGCAACATAAAATGAGCATGG - Intergenic
1068480979 10:57587632-57587654 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1068644686 10:59452494-59452516 TTGGGCAGCTAAAATAATCAAGG - Intergenic
1069104346 10:64364516-64364538 TTGGAAACCTAAAAGGAACAAGG - Intergenic
1069318541 10:67138919-67138941 TTGGAAAACAGAAATGAGCACGG + Intronic
1069386875 10:67891387-67891409 ACAGACACCTAAAATGTGCATGG - Exonic
1069899484 10:71699163-71699185 TTGAACACCTACAATGTGCCTGG - Intronic
1071212996 10:83366172-83366194 TTGGAACCCTAACATGAACAGGG + Intergenic
1071405621 10:85328159-85328181 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1072193363 10:93094041-93094063 TTGAAGACCTACAGTGAGCAAGG - Intergenic
1072749068 10:97963549-97963571 TTGTACACCTACAATGTGCTGGG - Intronic
1073701103 10:105927578-105927600 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1075660412 10:124191382-124191404 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1076367960 10:129934400-129934422 TTGGGCACCTACTATGTGCAAGG - Intronic
1077894906 11:6446962-6446984 GTGAACACCTAAAAGTAGCAGGG - Intergenic
1079258064 11:18849820-18849842 TTGAACACCTAATATGTGCCAGG - Intergenic
1079273458 11:19011373-19011395 ATGGACATCAAAAGTGAGCAGGG - Intergenic
1079597635 11:22270519-22270541 TTGAACACCTACCATGTGCAAGG - Intronic
1079634136 11:22714195-22714217 ATGGAAACCAAAAGTGAGCAGGG + Intronic
1080082803 11:28241073-28241095 TTGAACACCTACAATGTGCCAGG + Intronic
1080917776 11:36677362-36677384 TTGGCCTCATAAAATGAGCTAGG - Intergenic
1081506884 11:43727095-43727117 TTGTTCACTGAAAATGAGCATGG - Intronic
1082834717 11:57643174-57643196 TTGGACAACAAAAATTAGCCAGG - Intergenic
1083122050 11:60522465-60522487 TTGGATAGCAATAATGAGCAAGG + Intronic
1083518214 11:63280782-63280804 ATGGAAACCAAAAGTGAGCAGGG - Intronic
1086592314 11:88530136-88530158 TTGGACAGGTAGAATGAGCATGG - Intronic
1086758678 11:90599116-90599138 TTGGCCTCATAAAATGAGTAGGG - Intergenic
1087100785 11:94362385-94362407 TTGGCCTCATAAAATGAGTAAGG - Intergenic
1087503534 11:98991487-98991509 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1088137507 11:106576111-106576133 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1089952696 11:122544786-122544808 ATGAACACCAAAAGTGAGCAGGG - Intergenic
1090545447 11:127761384-127761406 ATGGAAACCAAAAGTGAGCAGGG + Intergenic
1091210268 11:133852271-133852293 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1093488506 12:19679457-19679479 ATGGACACCAAAAGTGAGCAGGG - Intronic
1094280571 12:28732867-28732889 TTGATCACCTACAATGTGCAAGG + Intergenic
1095518430 12:43033368-43033390 TTTGTCACCTTACATGAGCATGG + Intergenic
1095732949 12:45524777-45524799 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1095759738 12:45816979-45817001 TTGTAGAACTAAAATTAGCATGG + Intronic
1096348090 12:50868317-50868339 ATGGACACCAAAAGAGAGCAGGG + Intronic
1097295704 12:57960085-57960107 ACGGACACCAAAAGTGAGCAGGG + Intergenic
1097385757 12:58948562-58948584 ATGGACACCAAAAATGAGCAGGG - Intergenic
1098207165 12:68123635-68123657 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
1098313066 12:69166788-69166810 TTTGACACTTCAAATGAGTAAGG + Intergenic
1099233951 12:80059941-80059963 TTGGGCACCCACAATGTGCAAGG + Intergenic
1099488935 12:83263773-83263795 TTGGATACCTAAATTGAACGTGG + Intergenic
1099777226 12:87149461-87149483 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1099780280 12:87185161-87185183 TTGGACACCTAATATGTGCCAGG + Intergenic
1100290795 12:93213067-93213089 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1101132179 12:101700200-101700222 TTGAACACTTAGAAAGAGCAGGG + Intronic
1101513364 12:105412207-105412229 TTGGATACCTACTATGAGCCAGG - Intergenic
1101635066 12:106533598-106533620 ATGGACACCAAAAGTGAGCAGGG - Intronic
1103215579 12:119199125-119199147 CTGGACACCTACCATGTGCAAGG + Intronic
1103336501 12:120194277-120194299 TTGAGCACCTACTATGAGCAGGG - Intronic
1105708814 13:22985522-22985544 TTTGTCACCTAATATGTGCAAGG - Intergenic
1105908483 13:24837046-24837068 ATGGACACCAAAAACGAGCAAGG + Intronic
1105930961 13:25051374-25051396 ATGAACACCAAAAGTGAGCAGGG + Intergenic
1106937953 13:34745387-34745409 ATGGACACCAAAAACAAGCAGGG - Intergenic
1107465385 13:40645261-40645283 TAGGACCTTTAAAATGAGCAGGG - Intronic
1107755780 13:43621063-43621085 ATGGACACCAAAAACGAGCTGGG - Intronic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1108549457 13:51528683-51528705 ATGGAAACCAAAAAAGAGCAGGG + Intergenic
1108831847 13:54488899-54488921 ATGGACACCAAAATTAAGCAGGG + Intergenic
1109213380 13:59561194-59561216 ATGGACACCAAACATGAGCAGGG - Intergenic
1111165558 13:84453655-84453677 ATGGACACCAAAAGTGAGTAGGG - Intergenic
1112035194 13:95491075-95491097 ATGGACACCAAAAGCGAGCAGGG - Intronic
1112747514 13:102543396-102543418 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1113383450 13:109825577-109825599 TTGGACTCATAAAATGAGTTGGG + Intergenic
1113738706 13:112696585-112696607 CTGGAAGCCAAAAATGAGCACGG - Intronic
1114200879 14:20518853-20518875 TTGAACACCTACAATGCACAAGG - Intergenic
1114970552 14:28022066-28022088 TTGTATATCTAAAATGAGAAAGG + Intergenic
1115019811 14:28662802-28662824 TTGGCCTCATAAAATGAGCGAGG - Intergenic
1115695043 14:35887845-35887867 CTGGACACCTAGAATAAGCAGGG - Intronic
1115835286 14:37395835-37395857 ATGAACACCAAAAGTGAGCAGGG - Intronic
1116088797 14:40277515-40277537 ATGGACACAGAAAGTGAGCAGGG - Intergenic
1116223582 14:42118734-42118756 ATGGACACCAAAAACAAGCAGGG - Intergenic
1116253668 14:42520584-42520606 ATGGACACCAAAAAAGAACAGGG + Intergenic
1116335705 14:43653453-43653475 ATGAACACCAAAAGTGAGCAGGG + Intergenic
1116402028 14:44519361-44519383 CTGGAAACCAAAAATGAACAAGG - Intergenic
1116732195 14:48638002-48638024 ATGGACACCAAAAGTGAGCAAGG + Intergenic
1117112969 14:52477494-52477516 ATGGACACCAAAAGCGAGCAGGG + Intronic
1118234686 14:63991810-63991832 TTGAACACTTATAATGAGCTGGG + Intronic
1118517285 14:66544510-66544532 TTGGGCACTTACAATGTGCAAGG - Intronic
1118551408 14:66955113-66955135 CTGGCCACTTAAAATGAGCTAGG + Intronic
1118828913 14:69410859-69410881 TTTGACTACTAAAATGGGCATGG + Intronic
1119098672 14:71858271-71858293 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1121072294 14:91035371-91035393 TGGGACACTAAAAATGAGTAGGG + Intronic
1121090580 14:91179093-91179115 TTGAACACCTATTATGCGCAAGG + Intronic
1121496125 14:94392268-94392290 TCGGAAAGCCAAAATGAGCACGG - Intergenic
1121516378 14:94554497-94554519 ATGGACACCAAAAGTGGGCAGGG - Intergenic
1121747506 14:96309993-96310015 TTGGACACCTAACAACAGTAGGG + Intronic
1125336577 15:38632352-38632374 ATAAGCACCTAAAATGAGCAGGG + Intergenic
1126265624 15:46750004-46750026 TTGAACTCATAAAATGAGTAGGG - Intergenic
1127367454 15:58304930-58304952 TTGCACACTTAAAATGGGCCTGG + Intronic
1127567565 15:60207323-60207345 TTGGAAAACTATAATCAGCAAGG - Intergenic
1127731848 15:61809015-61809037 CTGGCCCCCTACAATGAGCAGGG - Intergenic
1128238947 15:66086993-66087015 CTGGACACCAAAAGCGAGCAGGG + Intronic
1129097389 15:73223602-73223624 ATGGACACCAAAAGCGAGCAGGG - Intronic
1129181231 15:73877556-73877578 TTGGCCTCATAAAATGAGTAGGG - Intronic
1129928880 15:79391902-79391924 ATGGACACCAAAAGTAAGCAGGG - Intronic
1131589205 15:93730403-93730425 TTGGCCTCATAAAATGAGCTAGG + Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1132232707 15:100196032-100196054 TTGAACACCTACTATGTGCAGGG - Intronic
1134528072 16:14959983-14960005 TTTGTCACCTGAAATGAGAATGG + Intergenic
1135552684 16:23410102-23410124 TTGAGCACCTAAAAAGGGCAAGG - Intronic
1135901845 16:26467083-26467105 ATGGACACCAAACGTGAGCAGGG + Intergenic
1137705287 16:50531426-50531448 TTAGACACCTAAAGGGAACAGGG - Intergenic
1138986760 16:62338391-62338413 TTCTACACTGAAAATGAGCAGGG - Intergenic
1139368752 16:66451624-66451646 TTGGGCACCTATTATGAGCCAGG + Intronic
1139987713 16:70913946-70913968 ATGGACACCAAAAGAGAGCAGGG - Intronic
1141212517 16:81994529-81994551 TTTGTCACCAAAAAGGAGCATGG + Exonic
1142476968 17:194361-194383 TTGCAGACCAGAAATGAGCAGGG - Intergenic
1143085182 17:4410785-4410807 TTGTACACCTTAAATGAACATGG + Intergenic
1143991028 17:10961759-10961781 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1144601692 17:16620694-16620716 TTGGACACCTTCAATGTGCCAGG - Intergenic
1146086302 17:29833402-29833424 ATGGAAACCAAAAAAGAGCAAGG - Intronic
1146751242 17:35383053-35383075 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1148185339 17:45639171-45639193 TTGTACGCCTCAAATGGGCAGGG + Intergenic
1148408045 17:47437579-47437601 ATGGACACCAAAAGTGAGCAGGG - Intronic
1152713649 17:81887695-81887717 TTGGACACCTGAAGTTGGCATGG - Intergenic
1153168718 18:2291511-2291533 ATGGACACCAAAAGTGAGCAAGG - Intergenic
1153363581 18:4227031-4227053 ATGGAAACCAAAAAAGAGCACGG + Intronic
1153400674 18:4680940-4680962 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1155799850 18:30087747-30087769 TTGGCCTCCTAAAATGTGCTGGG + Intergenic
1156011117 18:32499189-32499211 ATGGACACCAAAAGTGAGGAGGG - Intergenic
1156792869 18:40998806-40998828 ATGGACACCAAAAGAGAGCAGGG + Intergenic
1157137227 18:45068262-45068284 TTGTACATTTAAAATGAACATGG + Exonic
1157541052 18:48507309-48507331 ATGGACACCAAAAGTGATCAGGG + Intergenic
1157648947 18:49307545-49307567 GTGGTCAGCTAAAATGAGGAAGG + Intronic
1157967173 18:52221564-52221586 TTGGACACAGAAAATGTGAATGG + Intergenic
1157973009 18:52292740-52292762 AAGAACACCTCAAATGAGCATGG - Intergenic
1158025671 18:52894332-52894354 TTGGACATCTAATATGTGCCAGG - Intronic
1158756713 18:60333756-60333778 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1158824679 18:61203245-61203267 TTGGAAACCTTAAATAGGCAGGG - Intergenic
1159943502 18:74426571-74426593 TTGAACACCTACAATGTGCCCGG - Intergenic
1160267414 18:77352066-77352088 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1164319930 19:24135254-24135276 ATGGACACCAAAAACAAGCAGGG - Intergenic
1166604046 19:44124834-44124856 ATGGACACCAAAAATGAGCAGGG - Intronic
1168395877 19:56048041-56048063 ATGGACACCAAAAGCGAGCAGGG - Intronic
1168458213 19:56531932-56531954 ATGGACACCAAAAAGAAGCAGGG - Intergenic
924973042 2:148431-148453 ATGGAAACCAAAAAGGAGCAAGG - Intergenic
925002275 2:414106-414128 TTGGAAACCAAAAAATAGCAAGG - Intergenic
925753986 2:7116346-7116368 TTGAACACCTACTATGTGCAGGG + Intergenic
927328147 2:21830638-21830660 ATGGACACCAAAAGAGAGCAGGG - Intergenic
927367025 2:22308862-22308884 TTTTATACATAAAATGAGCAGGG - Intergenic
928733913 2:34263324-34263346 ATGGACACCAAAAGTGAGCAGGG + Intergenic
928856171 2:35804971-35804993 ATGGACACTGAAAATGAGCAGGG + Intergenic
929350761 2:40950848-40950870 TTGGACACAAAAAATGAATAGGG + Intergenic
929659689 2:43771417-43771439 GTGAACACCTAACATGAGCTGGG - Intergenic
930469772 2:51797339-51797361 ATGATCACCAAAAATGAGCAGGG + Intergenic
930962004 2:57273356-57273378 TTGGACTCATAAAATGAGTTAGG + Intergenic
931524963 2:63143239-63143261 ATGGACACCAAAAGCGAGCAGGG - Intronic
931886376 2:66622523-66622545 TTGGTCTCCTAAAATGAGTTAGG + Intergenic
932270507 2:70404895-70404917 ATGGACACCAAAAGTGAGCAGGG + Intergenic
934895329 2:98114522-98114544 CTGGAGAGCTAAAAAGAGCAAGG - Intronic
935954172 2:108358719-108358741 ATGGACACCAAAAGTGAGCAGGG + Intergenic
936643257 2:114340306-114340328 TTGCACACTTCAAATAAGCAGGG - Intergenic
937058071 2:118956313-118956335 ATGGACACCAAAAGTGAGCAGGG + Intronic
937092581 2:119216297-119216319 TTTGACACCTAGAAAGAACAAGG - Intergenic
937781776 2:125846981-125847003 ATGGACACCAAAAGTGAGCAGGG - Intergenic
938037835 2:128051010-128051032 ATGGACACCAAAAGAGAGCAGGG - Intergenic
939662995 2:144913704-144913726 TTGGACAACTGAAATCAGAAAGG + Intergenic
939876360 2:147582956-147582978 CTGGACTCCTAAAATGAGTTAGG + Intergenic
939951895 2:148485200-148485222 TTGGTCACCTAAAATTAACATGG - Intronic
940172162 2:150841171-150841193 ATGGACACCAAAAGTGAGCAGGG - Intergenic
940709195 2:157142142-157142164 AAGGACACCAAAAGTGAGCAGGG - Intergenic
940784784 2:157969791-157969813 ATGGACACCAAAAGTAAGCAGGG - Intronic
941317481 2:164011875-164011897 CTAGCCACCTAAAATGAGGATGG + Intergenic
941766255 2:169300139-169300161 TTGCACACCTATAGTGTGCAAGG + Intronic
942001263 2:171650031-171650053 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
942725141 2:178997853-178997875 TTGAACACTTAAAATGAGCCTGG + Intronic
942726286 2:179011292-179011314 ATGGACACCAAAAATGAGCAGGG + Intronic
943602845 2:189941986-189942008 CTGGAAACCAAAAAAGAGCAGGG + Intronic
943891088 2:193288361-193288383 ATGGACACCAAAAGTGAGCAGGG - Intergenic
944891052 2:204117732-204117754 TTGGACACCAAACAAGAGCTTGG - Intergenic
945825952 2:214719929-214719951 ATGGACACCAAAAGCGAGCAGGG + Intergenic
946037564 2:216756020-216756042 TTGTACAGATAAAATGAGGATGG + Intergenic
946052465 2:216875266-216875288 TTGGATACCAAAAATCAGGACGG - Intergenic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
947439451 2:230106172-230106194 ATGGAAACCAAAAAAGAGCAGGG - Intergenic
1168851233 20:978460-978482 GTGGGCACCTACAATGTGCAGGG - Intronic
1170245549 20:14218333-14218355 ATGGACACCAAAAGTGAGCAGGG - Intronic
1170372933 20:15669308-15669330 TTGCACACATGAAATGTGCAGGG + Intronic
1171081397 20:22189086-22189108 ATGGACACCAAAAGTGAGAAGGG - Intergenic
1172795315 20:37532880-37532902 TTGGTTACCTAAAATGTGCCAGG + Intergenic
1173110150 20:40179668-40179690 TTGTGAACCTAAAATGAGCCAGG + Intergenic
1174119806 20:48255708-48255730 TTGGCCTCATAAAATGAGCTGGG - Intergenic
1174651746 20:52131541-52131563 ATGGAAACCAAAAAAGAGCAGGG + Intronic
1176893215 21:14344500-14344522 GTGGACACATAAAATGAGTGAGG - Intergenic
1177121966 21:17148761-17148783 ATGGAAACCAAAAAAGAGCAAGG + Intergenic
1177474165 21:21597055-21597077 ATGGAAAACTAAAAAGAGCAAGG - Intergenic
1178598248 21:33974007-33974029 TTGGACCCCTAAAATGACATGGG - Intergenic
1178801881 21:35803239-35803261 ATGGACACCAAAAGCGAGCAGGG + Intronic
1183247696 22:36706528-36706550 TTGGACTCCCAAAATGGGCTGGG + Intergenic
1183314434 22:37129142-37129164 TTGGACACCTGCTATGAGCCTGG + Intronic
1184972772 22:48038535-48038557 TTGGGCACTTATTATGAGCAAGG + Intergenic
950820096 3:15748012-15748034 ATGGACACCAAATGTGAGCAGGG - Intronic
951572282 3:24077229-24077251 ATGGACACCAAAAGTGAGCAGGG - Intergenic
951852112 3:27152833-27152855 ATGGACACCAAAAGTGAGCAAGG + Intronic
953242180 3:41159379-41159401 TTGAACACCTATGATGAGCTAGG + Intergenic
953723690 3:45379364-45379386 ATGGACACCAAAAGTGTGCAGGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955859899 3:63317553-63317575 ATGGACACCAAAAGTGAGCAGGG - Intronic
956582325 3:70828054-70828076 TTGAACACCTACTATGTGCATGG - Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957907090 3:86570866-86570888 TTGGGAACCAAAAATGAGCAGGG + Intergenic
958969725 3:100598805-100598827 ATGGACACCAAAAGTGAGCAGGG - Intergenic
959382230 3:105654684-105654706 TTGTAAGCCTAAAAGGAGCAAGG - Intergenic
959899264 3:111641318-111641340 ATGGACACCAAAAGCGAGCAGGG + Intronic
959998277 3:112702047-112702069 ATGGACACCAAAAGTGAGAAGGG + Intergenic
961599285 3:128046719-128046741 TTGGAGACCAAAAATTAGCCGGG - Intergenic
962308269 3:134307874-134307896 TTGATCACCTAATATGTGCAAGG - Intergenic
962424797 3:135260408-135260430 TTAGACAGATAAAATTAGCAAGG - Exonic
962769360 3:138598048-138598070 TTGGGCACTTAAAATGTGCTAGG + Intergenic
964601042 3:158501670-158501692 ATGGACACCAACAGTGAGCAGGG - Intronic
964968463 3:162528496-162528518 TTGGACTCATAAGATGAGTAGGG + Intergenic
965052527 3:163669499-163669521 AAGGACACCAAAAGTGAGCAGGG - Intergenic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
967691799 3:192482889-192482911 TTGGAAAGATAAAATGTGCATGG + Intronic
968125447 3:196156222-196156244 ATGGACACCAAAAGTGAGCAGGG - Intergenic
970346530 4:15158468-15158490 ATGGACACCAAAAGTCAGCAGGG - Intergenic
972652921 4:41036746-41036768 TTAAACACCTAGAATGTGCAAGG + Intronic
972769484 4:42184004-42184026 GTGGACTCCTAAAAGGAGGATGG + Intergenic
973571122 4:52240826-52240848 TAGGCCACCTAAAATGTGTAAGG + Intergenic
973782648 4:54302976-54302998 ATGGACACCAAAATCGAGCAGGG + Intergenic
975228331 4:71901094-71901116 TTAGAAAAATAAAATGAGCATGG - Intergenic
975271726 4:72443061-72443083 TTTGACACATTAACTGAGCAAGG - Intronic
976337888 4:83911864-83911886 TTGGACACCTATCATTAGAATGG + Intergenic
976556399 4:86455476-86455498 ATGGACACCAAAAGTGAGCAGGG + Intronic
976686128 4:87817550-87817572 ATGGACACCAAAAGTGAGCAGGG - Intergenic
976708583 4:88044078-88044100 TTGGACACTTAATATGGGCTAGG + Intronic
977019789 4:91745007-91745029 ATGAACACCAAAAGTGAGCAGGG - Intergenic
977148779 4:93481823-93481845 AGGGACAGCAAAAATGAGCAGGG + Intronic
977559120 4:98514756-98514778 TTGAGCACCTACCATGAGCAAGG + Intronic
977817614 4:101433098-101433120 TTGGAAACCTATATTGAGGAAGG + Intronic
977854981 4:101878277-101878299 ATGGAAACCAAAAAAGAGCAGGG + Intronic
978349983 4:107811492-107811514 CTGGCCACCTAATCTGAGCATGG - Intergenic
978726477 4:111975744-111975766 ATGGACACCAAAAGCGAGCAGGG - Intergenic
978753134 4:112274581-112274603 TTGGAAACATAAAAAGAGCCAGG + Exonic
978999231 4:115197556-115197578 ATGGGCACCAAAAGTGAGCAAGG - Intergenic
979662589 4:123275115-123275137 TTGAACACATAAAATGAGAATGG - Intronic
979995610 4:127427139-127427161 ATGGACACCAAAAGTGAGCAGGG + Intergenic
980087007 4:128401919-128401941 ATGGACACCAAAAGTGAGCAGGG - Intergenic
980523808 4:133963161-133963183 ATGGACACCAAAATTGAGCAGGG + Intergenic
981461575 4:145018768-145018790 ATGGACACCAAAAGTGAGCAGGG + Intronic
981649811 4:147043980-147044002 TTGAGCACATAAAATGAGGAAGG - Intergenic
982608606 4:157545076-157545098 CTGGAAACCAAAAAAGAGCAGGG - Intergenic
982800487 4:159699908-159699930 TTGGCCTCCTAAAATGAGTTTGG + Intergenic
983021226 4:162677473-162677495 ATGAACACCAAAAAAGAGCAGGG + Intergenic
984323855 4:178226981-178227003 ATGGACAGCAAAAGTGAGCAGGG + Intergenic
984542465 4:181057071-181057093 TTGAATACCTAATATAAGCAAGG + Intergenic
984721930 4:182980570-182980592 ATGGACACCAAAAGTGAGCAGGG + Intergenic
985093109 4:186383757-186383779 ATGGACACCAAAGACGAGCAGGG + Intergenic
986579499 5:9250178-9250200 TTGGGAACCTGAAATTAGCAGGG + Intronic
987649801 5:20726072-20726094 TTGGCCTCATAAAATGAGCTAGG - Intergenic
988176880 5:27739265-27739287 TTGTACACCTAAAATGTGCCAGG + Intergenic
988731560 5:33977662-33977684 TTGAACACCTACAATATGCAAGG + Intronic
988745757 5:34135424-34135446 TTGGCCTCATAAAATGAGCTAGG + Intergenic
988902437 5:35747505-35747527 ATGGACACAAAAAGTGAGCAGGG + Intronic
989009190 5:36850923-36850945 TTGGACTCATAAAATGAGTTAGG - Intergenic
990176613 5:53114993-53115015 TTGTACACCTACAAGGTGCAAGG - Intergenic
990219719 5:53574571-53574593 CTGGACTCATAAAATGAGCTGGG + Intronic
990712627 5:58602662-58602684 ATGAACACCAAAAGTGAGCAGGG - Intronic
991010841 5:61881600-61881622 TTTGACATTGAAAATGAGCAAGG - Intergenic
991164889 5:63554202-63554224 AAGAACACCTAAAATGAGCATGG + Intergenic
991329562 5:65479161-65479183 TTAAACACCTGAAAGGAGCATGG - Intronic
991387202 5:66103179-66103201 ATGGACACCAAAAACAAGCAGGG + Intergenic
993964948 5:94348637-94348659 ATGGACACCAAAAGTGACCAGGG + Intronic
994330074 5:98494147-98494169 ATGGACACCAAAAACAAGCAAGG + Intergenic
994715378 5:103315337-103315359 TTGGACACTCAAAATGTGCCAGG - Intergenic
994862342 5:105213768-105213790 TTGATCACCTAATATGTGCAAGG - Intergenic
995955533 5:117771792-117771814 ATGGACACCAAAAGTGAGCAGGG + Intergenic
996288739 5:121827181-121827203 ATGGACACCAAAAGTAAGCAGGG - Intergenic
996427286 5:123328460-123328482 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
996678538 5:126204159-126204181 ATGGACACCAAAAGTGAGCAGGG + Intergenic
997572726 5:134944302-134944324 TTGTACACCAGAAATGAACATGG + Intronic
997670424 5:135666807-135666829 TTGGCCCTCCAAAATGAGCAAGG - Intergenic
997761133 5:136448404-136448426 ATGGACACCAAAAGTGAGCAGGG + Intergenic
999252217 5:150189653-150189675 TTGAGCACCTAAAATGTGCCAGG - Intergenic
999484491 5:151981988-151982010 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1001040054 5:168328087-168328109 TTGGACTCCTAAATTGTGAAAGG - Intronic
1002814071 6:661974-661996 ATGGACACCAAAAGAGAGCAGGG + Intronic
1003063357 6:2879596-2879618 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1003451089 6:6232272-6232294 ATGGACACCAAAAGCGAGCAGGG + Intronic
1003582222 6:7350079-7350101 ATGGACACCAAAAGCGAGCAGGG + Intronic
1003831831 6:10020485-10020507 TTGAACACCTACTATGTGCAGGG - Intronic
1004412024 6:15390000-15390022 TTTGACAACTTAAATGAGGAGGG + Intronic
1005072707 6:21876513-21876535 ATGGACACCGAAAGTGAGCAGGG + Intergenic
1005543917 6:26843659-26843681 TTGGCCTCATAAAATGAGCTAGG + Intergenic
1006174096 6:32111484-32111506 TTGGTCACCTACACTGTGCAAGG - Intronic
1006233315 6:32604389-32604411 CTGGAAATCTAAAAGGAGCATGG - Intergenic
1007805910 6:44446075-44446097 TTGGAAACAGAAAATGAGTAAGG - Intronic
1008256335 6:49304657-49304679 ATGGACACAAAAAACGAGCAGGG + Intergenic
1008469486 6:51867467-51867489 TTGAACACTTAAAAAGAGCTTGG + Intronic
1008725949 6:54419418-54419440 TTGAGCACCTACAATGTGCAAGG + Intergenic
1008973374 6:57396471-57396493 ATGGACACCAAAAGTGAGCAGGG - Intronic
1009014697 6:57885329-57885351 TTGGCCTCATAAAATGAGCTAGG + Intergenic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009162277 6:60298015-60298037 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009453379 6:63827094-63827116 ATGGACACCAAAAGCGAGCAGGG + Intronic
1009647856 6:66430156-66430178 TGGGACATCTAAAATTAGCGTGG - Intergenic
1009679380 6:66872262-66872284 TTGGCCTCCTAAAATGAGTTAGG + Intergenic
1009804607 6:68586880-68586902 TTGGCCTCCTAAAATGAGTTTGG - Intergenic
1010017210 6:71119278-71119300 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1011327356 6:86163785-86163807 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1011328875 6:86181996-86182018 ATGGACACCAAAATTGATCAGGG - Intergenic
1011789518 6:90883594-90883616 ATGGACAACAAAAGTGAGCAGGG - Intergenic
1012050159 6:94331251-94331273 ATGGACACTTAAAAAGAGTAGGG + Intergenic
1012600401 6:101090036-101090058 ATGGAAACCAAAAGTGAGCAAGG - Intergenic
1012684790 6:102232510-102232532 ATGGACACCAAAAACAAGCAGGG - Intergenic
1012738029 6:102975658-102975680 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1013069694 6:106717199-106717221 TTGTTCACCTTATATGAGCATGG - Intergenic
1013587204 6:111590321-111590343 TGGGACACCTAACACCAGCATGG - Intronic
1013702813 6:112794812-112794834 TTGGCCACACAACATGAGCAGGG + Intergenic
1014304639 6:119725599-119725621 ATAGACACCAAAAGTGAGCAGGG - Intergenic
1014531182 6:122561734-122561756 ATGGACACCAAAAGCGAGCAGGG - Intronic
1015565787 6:134569242-134569264 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1015591582 6:134827768-134827790 ATGGACACCTACCATGAGCCTGG + Intergenic
1015849591 6:137558270-137558292 ATGGACACCTAAAGCAAGCAGGG - Intergenic
1015903391 6:138090633-138090655 TTGGACACCTAAAATGAGCAAGG + Exonic
1016197249 6:141359613-141359635 ATGGACACCAGAAGTGAGCAGGG - Intergenic
1016458406 6:144256466-144256488 TTGGCCTCATAAAATGAGCTTGG + Intergenic
1017190282 6:151646502-151646524 ATGGACACCAAAAGTGAGTAGGG - Intergenic
1017359506 6:153550405-153550427 TTGAACTCCTAAAAAGATCATGG + Intergenic
1018009606 6:159657614-159657636 ATGGACACCAAAAATGACCAGGG + Intergenic
1018417050 6:163610820-163610842 CAGGACACCTAAAATGGGCTGGG - Intergenic
1020332171 7:7030565-7030587 ATGGAAACCAAAAGTGAGCAGGG - Intergenic
1020534376 7:9376199-9376221 TTTAAAACCTAAAATGAACAAGG + Intergenic
1021323314 7:19238635-19238657 ATGGACACCAAAGGTGAGCAGGG - Intergenic
1022346185 7:29516769-29516791 TTGGATACCTGAAATGAACTAGG + Intergenic
1023344610 7:39258810-39258832 TTTGTCACGTGAAATGAGCAAGG - Intronic
1023701473 7:42895426-42895448 ATGGACACCAAAAGTGAACAGGG + Intergenic
1023748760 7:43349676-43349698 ATGGACACCAAAAGTGAGCAGGG - Intronic
1024545710 7:50515746-50515768 ATGGACACCAAAAGTAAGCAGGG + Intronic
1024917016 7:54513366-54513388 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1027882204 7:83854942-83854964 TTGAGCACCTATAATGTGCAAGG - Intergenic
1028642209 7:93054874-93054896 TTAAACACCTACTATGAGCAGGG - Intergenic
1029547887 7:101220602-101220624 TTGGACACTTACTATGAGCCAGG - Intronic
1030936204 7:115587211-115587233 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1031077150 7:117223863-117223885 TTGAAAACCTACTATGAGCAAGG - Exonic
1032511612 7:132477115-132477137 TTGGTCATCTAAAATGCGCTAGG - Intronic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1036661645 8:10713164-10713186 TTGGACACCTACTATGTGCCTGG + Intergenic
1036915392 8:12799375-12799397 TTTGTCACCTGCAATGAGCAAGG + Intergenic
1037006086 8:13782001-13782023 TAGGACACCTACAATGTACAAGG - Intergenic
1039641682 8:39229519-39229541 ATGGACACCAAAAGTGAGCAGGG + Intronic
1041227981 8:55719045-55719067 ATAGACACCAAAAGTGAGCAGGG + Intronic
1041293457 8:56331017-56331039 ATGGACACCAAAATCGAGCAGGG - Intergenic
1041877773 8:62710540-62710562 ATGGACACTAAAAGTGAGCAGGG - Intronic
1042122615 8:65505196-65505218 ATGGACATCAAAAGTGAGCAGGG - Intergenic
1043040982 8:75261507-75261529 ATAGACACCAAAAATGGGCAGGG + Intergenic
1043816677 8:84810809-84810831 ATGGACACCAAAAGTGAACAGGG - Intronic
1045553005 8:103189520-103189542 TTGGACACTTGGAATAAGCAAGG + Intronic
1045766677 8:105680303-105680325 TTGAACTCTTAAAATAAGCAAGG - Intronic
1046279974 8:112015172-112015194 TTGGACACATAAAATGTGTTGGG - Intergenic
1046442234 8:114272546-114272568 TTATACACCTAGCATGAGCAGGG - Intergenic
1047032570 8:120898258-120898280 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1047332357 8:123902627-123902649 ATGGACACCAAAAGCGAGCAGGG - Intronic
1048524058 8:135185102-135185124 TTGAACACCTAGAATAAACAAGG - Intergenic
1048750590 8:137669518-137669540 TTAGACTCCAAAAAAGAGCATGG + Intergenic
1050733032 9:8731217-8731239 TTGGACACATTAAATTAACATGG + Intronic
1051029947 9:12661323-12661345 ATGGAAACCAAAAAAGAGCAAGG + Intergenic
1051043308 9:12842196-12842218 TTTGACATCTCAAATTAGCATGG + Intergenic
1051362892 9:16296762-16296784 ATGGACACCAAAAGTGAGCCGGG + Intergenic
1053023673 9:34713506-34713528 TTGGACACTTATAACAAGCAGGG - Intergenic
1056319966 9:85426660-85426682 TTGTACACTTAAAATGGGTAAGG + Intergenic
1056322526 9:85450205-85450227 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1056464769 9:86842939-86842961 TTGGCCACCAAAAATGGGTAAGG - Intergenic
1057119251 9:92556653-92556675 ATAGACACCAAAAGTGAGCAGGG - Intronic
1058148052 9:101433118-101433140 TTGAGCAACTACAATGAGCAGGG - Intronic
1058410665 9:104727198-104727220 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1058622995 9:106903743-106903765 ATGGACACCAAAAGTGAGCAGGG - Intronic
1058770870 9:108230184-108230206 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1059864355 9:118497987-118498009 TTGGACTCATAAAATGAGTTAGG + Intergenic
1059869745 9:118559383-118559405 TTAGGCACCTGATATGAGCAAGG - Intergenic
1060539530 9:124420176-124420198 CTGGACACCTAGAATGTGCCAGG + Intergenic
1061701502 9:132419748-132419770 TTGAACACCTACAATGTGCAAGG + Intronic
1187218994 X:17305926-17305948 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1187773399 X:22728650-22728672 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1189191307 X:39109596-39109618 TTGGCCTCATAAAATGAGTATGG + Intergenic
1189199433 X:39179595-39179617 TTGGACTTATAAAATGAGCTGGG + Intergenic
1189413868 X:40796741-40796763 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1189656817 X:43253205-43253227 TTGGGTACCTAGAATGGGCAAGG - Intergenic
1189761089 X:44322326-44322348 TTGAACACCTACTATGTGCAAGG - Intronic
1189931919 X:46021409-46021431 ATGGACACCTAAAGCAAGCAGGG + Intergenic
1190449142 X:50560045-50560067 ATGGACACCAAAATCGAGCAGGG + Intergenic
1190476890 X:50837029-50837051 TTGGACACCTATTATGTGCCAGG + Intergenic
1190631995 X:52397007-52397029 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1190899352 X:54654011-54654033 TTGGAAACCAAAAAAGAGCAGGG + Intergenic
1190965450 X:55296072-55296094 TTGGACTCATAAAATGAGTTAGG + Intergenic
1191903376 X:66062497-66062519 ATGGGCACCAAAAGTGAGCAGGG - Intergenic
1191906089 X:66092078-66092100 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1191994274 X:67074111-67074133 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192044886 X:67661696-67661718 TTGGCCTCCTAAAATGAGTTAGG + Intronic
1192820431 X:74638974-74638996 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1192913445 X:75630197-75630219 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1193253197 X:79317606-79317628 ATGGACACCAAAAGTGAGCGGGG - Intergenic
1193578719 X:83234695-83234717 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193590154 X:83379549-83379571 ATGGACACCAAAACTGAGTAAGG - Intergenic
1193590894 X:83387542-83387564 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1193853348 X:86567648-86567670 CCGGACACCTACAATAAGCACGG - Intronic
1193991968 X:88319383-88319405 TTGGCCTCATAAAATGAGCTAGG + Intergenic
1194237397 X:91401105-91401127 ATGGACACCAAAGGTGAGCAGGG + Intergenic
1194285393 X:92004699-92004721 ATGGAAACCCAAAATGAGCAAGG - Intronic
1194317638 X:92400128-92400150 TTGAACACCTAAAATAAAAACGG - Intronic
1194354055 X:92858517-92858539 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1194370701 X:93067534-93067556 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1194574798 X:95598996-95599018 ATGGAAACCTAAAAAGAGCAGGG + Intergenic
1194748642 X:97658734-97658756 CTGGACACTTAAAATGAATAGGG - Intergenic
1195019307 X:100810831-100810853 ATGGACACCAAAAACGAGCAGGG - Intergenic
1195415409 X:104614812-104614834 ATGGAAACCAAAAAAGAGCAGGG - Intronic
1195984967 X:110619859-110619881 ATGGACACCAAAAGTGAGCAGGG - Intergenic
1196465042 X:115962949-115962971 ATGGACACCAAAAGTGAGCAGGG + Intergenic
1196526829 X:116737885-116737907 CTGGCCACATAAAATGAGTAAGG + Intergenic
1196737720 X:118994357-118994379 ATGGACACCCAAAATGAGCAGGG + Intronic
1197668879 X:129254029-129254051 ATGGACACCAAAAGCGAGCAGGG - Intergenic
1197865471 X:131012125-131012147 TTGGGCACCTACTATGTGCAAGG + Intergenic
1198250420 X:134874579-134874601 TTGGAAACCTTAAATGAGGCTGG + Intergenic
1198499264 X:137226406-137226428 TTGAACACTTACAATGAGCAAGG - Intergenic
1199286964 X:146064588-146064610 TCTGATACCTAAAATGATCAAGG - Intergenic
1199821547 X:151454099-151454121 ATGGACACCAAAAGCGAGCAGGG + Intergenic
1200602964 Y:5229238-5229260 ATGGAAACCCAAAATGAGCAAGG - Intronic
1200625815 Y:5513410-5513432 TTGAACACCTAAAATAAAAATGG - Intronic
1200662409 Y:5975536-5975558 ATGGAAACCAAAAGTGAGCAAGG + Intergenic
1200678493 Y:6179427-6179449 TTGGAAAACCAAAAAGAGCAAGG + Intergenic
1201405811 Y:13648949-13648971 TTGGCCACATAAAATGAGTTAGG + Intergenic