ID: 1015907526

View in Genome Browser
Species Human (GRCh38)
Location 6:138132354-138132376
Sequence AAGCAGTACTAAGACTAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015907526_1015907528 -6 Left 1015907526 6:138132354-138132376 CCGTCTTAGTCTTAGTACTGCTT No data
Right 1015907528 6:138132371-138132393 CTGCTTTCACGGTATCCCATAGG No data
1015907526_1015907529 0 Left 1015907526 6:138132354-138132376 CCGTCTTAGTCTTAGTACTGCTT No data
Right 1015907529 6:138132377-138132399 TCACGGTATCCCATAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015907526 Original CRISPR AAGCAGTACTAAGACTAAGA CGG (reversed) Intergenic
No off target data available for this crispr