ID: 1015910179

View in Genome Browser
Species Human (GRCh38)
Location 6:138161862-138161884
Sequence GCGCACCTGACCCAGGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015910166_1015910179 9 Left 1015910166 6:138161830-138161852 CCGGCCCCAGCCCGCAGCCGCCG 0: 1
1: 0
2: 9
3: 117
4: 1017
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910167_1015910179 5 Left 1015910167 6:138161834-138161856 CCCCAGCCCGCAGCCGCCGCCGA 0: 1
1: 0
2: 6
3: 58
4: 442
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910164_1015910179 22 Left 1015910164 6:138161817-138161839 CCAGCCTCACTCTCCGGCCCCAG 0: 1
1: 1
2: 6
3: 105
4: 2061
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910163_1015910179 25 Left 1015910163 6:138161814-138161836 CCTCCAGCCTCACTCTCCGGCCC 0: 1
1: 0
2: 3
3: 56
4: 640
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910169_1015910179 3 Left 1015910169 6:138161836-138161858 CCAGCCCGCAGCCGCCGCCGAGC 0: 1
1: 0
2: 9
3: 60
4: 413
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910173_1015910179 -8 Left 1015910173 6:138161847-138161869 CCGCCGCCGAGCGGAGCGCACCT 0: 1
1: 0
2: 1
3: 3
4: 43
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910171_1015910179 -1 Left 1015910171 6:138161840-138161862 CCCGCAGCCGCCGCCGAGCGGAG 0: 1
1: 0
2: 0
3: 14
4: 204
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910168_1015910179 4 Left 1015910168 6:138161835-138161857 CCCAGCCCGCAGCCGCCGCCGAG 0: 1
1: 0
2: 5
3: 37
4: 383
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910165_1015910179 18 Left 1015910165 6:138161821-138161843 CCTCACTCTCCGGCCCCAGCCCG 0: 1
1: 0
2: 4
3: 40
4: 550
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137
1015910172_1015910179 -2 Left 1015910172 6:138161841-138161863 CCGCAGCCGCCGCCGAGCGGAGC 0: 1
1: 0
2: 1
3: 36
4: 279
Right 1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015910179 Original CRISPR GCGCACCTGACCCAGGCGGG CGG Intergenic
900467452 1:2832792-2832814 GAGCCCCAGACCCAGGCTGGAGG - Intergenic
900641586 1:3690308-3690330 GCGCACCTGCCCCCTGCGCGGGG - Intronic
905151553 1:35931512-35931534 GCGCACCTGGGCCGGGCGGGAGG - Intronic
906318419 1:44802570-44802592 GAGCAGCTGGGCCAGGCGGGTGG + Intronic
915230762 1:154443846-154443868 GAGCACCTGGCACAGGAGGGAGG - Intronic
921671116 1:217925077-217925099 GCGCGCTCGGCCCAGGCGGGCGG + Intergenic
1062955616 10:1538549-1538571 GCACACCTGACCCAGACCTGCGG + Intronic
1067289947 10:44933264-44933286 GCACAACTGTCCCAGGCAGGTGG + Intronic
1068196901 10:53729093-53729115 GTGCACCTGAGCCAGGCATGTGG + Intergenic
1071301893 10:84262138-84262160 GCGCAGCTGACCCAGGACCGTGG + Intergenic
1071731873 10:88256275-88256297 GCTCACATGAGACAGGCGGGTGG - Intergenic
1072782018 10:98257773-98257795 GCGCACCTCACTCAGGTGGATGG + Exonic
1076199262 10:128545416-128545438 GCACACCTGCCCCAGTCCGGAGG - Intergenic
1076919997 10:133446360-133446382 CTGCACCTGCCCGAGGCGGGGGG - Intergenic
1077042996 11:532797-532819 GAGCCCCTCACCCAGGCAGGCGG - Intronic
1077516930 11:3007634-3007656 GGGGACCTGACCCAGCTGGGAGG + Intronic
1077541794 11:3150150-3150172 GCCCTCCTGCCCCAGGCAGGAGG + Intronic
1081330508 11:41794272-41794294 GCACACCTGGGCCAGGGGGGAGG - Intergenic
1083265853 11:61546560-61546582 CCGCCCCTGCCCCAGGCGGTGGG - Intronic
1083644803 11:64165950-64165972 GCGCAGCTGTGCCAGGCGGCCGG + Exonic
1084450296 11:69232864-69232886 GAGCCCCAGACCCAGGTGGGAGG + Intergenic
1084693368 11:70739620-70739642 GCCCAGCTGACCCTGGCTGGTGG - Intronic
1084860425 11:72014462-72014484 GCGCGGCTGACCCAGGAGCGGGG - Exonic
1084899380 11:72298288-72298310 GGGCACCTAATCCAGGCTGGAGG - Intronic
1090804505 11:130194451-130194473 GGGCTCCTGACCCAGGCGGTCGG - Intronic
1091262484 11:134245529-134245551 CCGCACCTCACCCAGGGAGGTGG - Exonic
1092773758 12:11922869-11922891 GCACACCTGACCCAGGGATGGGG + Intergenic
1094524802 12:31224540-31224562 GCAGACCTGACCCAGGCGCAAGG + Intergenic
1095356123 12:41277572-41277594 GCTCACCTGGTCCAGGTGGGTGG + Intronic
1097168261 12:57097094-57097116 GCTCATCTGGCCCAGGCTGGGGG + Exonic
1100260741 12:92929630-92929652 CCCTCCCTGACCCAGGCGGGAGG + Intergenic
1107398833 13:40048598-40048620 GGGCACCTGACCCATTTGGGGGG + Intergenic
1108373238 13:49791935-49791957 GCGAGCCGGGCCCAGGCGGGCGG - Intronic
1112337072 13:98524557-98524579 ATGCACCTCAGCCAGGCGGGTGG + Intronic
1119886440 14:78147339-78147361 GCGCAACAGACCCTGGCTGGTGG - Intergenic
1121049186 14:90809134-90809156 GGGCACCTGACCCAGGAGTAAGG - Intronic
1122918400 14:104869295-104869317 GGGCCCCTGACCCAGGTGGATGG + Intronic
1124019022 15:25903091-25903113 CAGCAACTGACCCAGGCTGGAGG - Intergenic
1125535863 15:40441053-40441075 GCGCGCCTGGCCGGGGCGGGCGG - Intronic
1125602977 15:40925680-40925702 CGGCATCTGTCCCAGGCGGGCGG + Intergenic
1126800845 15:52295492-52295514 GCGCACCTGACACGGCAGGGCGG - Intronic
1128617027 15:69118184-69118206 GGGCACGTCACCCAGGAGGGGGG + Intergenic
1132649364 16:1013672-1013694 GAGCTCCTGGCCCAGGCTGGTGG + Intergenic
1133113908 16:3565105-3565127 GCTCACCTGTCCCAGGCTGCTGG - Exonic
1136406774 16:30052922-30052944 GAGGATCCGACCCAGGCGGGCGG + Intronic
1137842282 16:51651442-51651464 GCGCACCAGCCCCAGGAGGGCGG - Intergenic
1138482276 16:57311394-57311416 GGGGAGCTGACCCAGGCTGGAGG - Intergenic
1142288074 16:89179558-89179580 GCTCACCTGAACCAGGGGGTAGG - Exonic
1142904399 17:3032740-3032762 CCGCTTCTGACCCAGGAGGGAGG + Intronic
1143190322 17:5035512-5035534 GCCCCCCTGAGGCAGGCGGGAGG - Intronic
1143886689 17:10070281-10070303 GGGCAGCTGACCCAGGCTGGTGG - Intronic
1144660328 17:17063906-17063928 GCCCAACTGCCCCAAGCGGGTGG - Intronic
1144952430 17:19001474-19001496 GCCCACCTGTCCGAGGCTGGAGG + Intronic
1145950316 17:28812269-28812291 GCTCAGCTGCCCAAGGCGGGCGG - Intronic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146913041 17:36660282-36660304 GCCCTCCTGACCCAGGTGGGTGG - Intergenic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1149521828 17:57323534-57323556 GAGCACCTGTCCCAGGGAGGCGG - Intronic
1153219155 18:2847145-2847167 GCGCTCCGGACCCGGGCAGGCGG + Exonic
1155064067 18:22253908-22253930 GCCCGGCTGACCCACGCGGGAGG - Intergenic
1160771072 19:831495-831517 GGGCACCTGGCCCAGCCTGGAGG + Intronic
1161422492 19:4183551-4183573 AGGCACCTGACCCAGGCTGGGGG + Intronic
1162330755 19:10027784-10027806 GCGCAGCTGCTCCGGGCGGGCGG + Intergenic
1163623534 19:18374682-18374704 GGGCACCTGACCGAGGCCAGAGG + Intergenic
1163816124 19:19465600-19465622 GCGCACCTCACACAGGTGAGTGG + Exonic
1166945118 19:46391529-46391551 GCGCACCTGACCCCAGAAGGCGG - Intronic
1167016130 19:46842282-46842304 GGGCACCTGACCCAGCCTGGGGG - Intronic
1167158391 19:47752805-47752827 GGGCACCTGGCCCAGCCTGGGGG + Intronic
1167853925 19:52222630-52222652 GCAGACCTGACCAAGGTGGGCGG + Intronic
930232533 2:48857623-48857645 GCACACACGACCCAGGCTGGAGG + Intergenic
934540963 2:95174654-95174676 GCTCACCTAACCCAGCAGGGAGG - Intronic
935193034 2:100793514-100793536 GTACACCTCACCCAGGCAGGAGG - Intergenic
938577843 2:132620544-132620566 GAGCACCTGAGCCACGCAGGGGG - Intronic
938877373 2:135546430-135546452 GCACAACTGAGCCAGGCTGGAGG - Intronic
942073444 2:172335814-172335836 CAGCACCTAACCCAGGAGGGTGG - Intergenic
946373501 2:219294758-219294780 GCGGAGCTGGCCCACGCGGGTGG + Intronic
948929666 2:241123951-241123973 GCTCACCGGACCCAGCCTGGTGG - Exonic
1168893268 20:1307767-1307789 GAGGCCCTGACCAAGGCGGGGGG - Exonic
1172888219 20:38246031-38246053 GAACACCTGACCCAGGACGGTGG + Exonic
1178493750 21:33070489-33070511 GCGCGCCTGACCCGGGCCCGGGG - Exonic
1179988289 21:44932867-44932889 CCGCACCGAACCCAGGCGGTCGG - Intronic
1181084276 22:20432092-20432114 GCGCTCCTGTCCTAGGGGGGTGG + Intronic
1182417233 22:30229246-30229268 GCGGACCTGACCCCAGCTGGAGG - Intergenic
1185018997 22:48362618-48362640 GCCCACCTGCCCCAGGTCGGGGG + Intergenic
1185081628 22:48712663-48712685 GTCCACCTGCCCCAGGCGAGGGG + Intronic
1185086514 22:48743787-48743809 AGGCACCTGACTCAGGAGGGCGG - Intronic
950470931 3:13185916-13185938 GGGCACCTGCCCAAGGTGGGCGG + Intergenic
951217841 3:20040887-20040909 GTGCAGCGGCCCCAGGCGGGAGG - Intronic
961458682 3:127036848-127036870 GCACTCCTGAGCCAGGCGCGGGG - Exonic
961929355 3:130517071-130517093 GCGCACGTCCCCCAGGAGGGGGG - Intergenic
967633136 3:191770547-191770569 ATGCACCTGACCCAGGAGGTGGG + Intergenic
968491349 4:892184-892206 GTGGAGCTGACCCAGGCGGTGGG - Intronic
968756093 4:2417375-2417397 GGGCACGAGCCCCAGGCGGGCGG + Intronic
968902813 4:3439277-3439299 GCGTACCTGCCCCAGCCTGGAGG + Intronic
968976910 4:3826910-3826932 GGGCACCAGACCCTGGGGGGTGG - Intergenic
970194047 4:13539225-13539247 GCGGAGCTGGCCCAGGCAGGGGG + Intergenic
971030935 4:22635892-22635914 GCTCACCTGACCCCTGCTGGCGG - Intergenic
972245651 4:37243926-37243948 GCGCACCTGGGCCGGGCGGGAGG - Intergenic
975800720 4:78057266-78057288 GCCCTCCTCACCCAGGCGAGGGG + Intergenic
975835418 4:78417926-78417948 GCATGCCTGACCCAGGCGAGGGG + Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
992431457 5:76715352-76715374 GCGCAGGTGACCCCGGCGGGCGG + Intergenic
997895045 5:137708915-137708937 GGACACCTGACCCAGTCTGGAGG + Intronic
998143222 5:139711265-139711287 GGGCACCGGGCGCAGGCGGGAGG + Intergenic
1002927332 6:1611862-1611884 TGGTACCTGAACCAGGCGGGCGG + Exonic
1007760019 6:44127982-44128004 GCGCACCTGCACCGGGCAGGTGG - Intronic
1011610639 6:89146707-89146729 ACACACCTGCCCCGGGCGGGAGG - Intronic
1011795437 6:90947491-90947513 GAGCTCCTGCCCCAGGCTGGAGG + Intergenic
1013233281 6:108175644-108175666 GCGCCCCAGGCCCAGGCAGGGGG + Intronic
1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG + Intergenic
1019012660 6:168854295-168854317 GTGCACCACACCCAGGCGTGTGG + Intergenic
1019621681 7:1995537-1995559 GCGCAGGAGCCCCAGGCGGGGGG + Intronic
1021489666 7:21205404-21205426 GTGCAGCTGACCCAGACGGCAGG + Intergenic
1024849325 7:53692078-53692100 GCCCTCCTGACCCTGGCAGGGGG + Intergenic
1026013512 7:66654733-66654755 GCGCAACTGCCCCAGCCGCGCGG - Intronic
1026025500 7:66740900-66740922 GCGCAACTGCCCCAGCCGCGCGG - Intronic
1034974297 7:155438950-155438972 GAGCATGTGACCCAGGCGTGGGG + Intergenic
1035239455 7:157520348-157520370 GTGCACCTGCTCCAGGCTGGTGG + Intergenic
1035530341 8:345992-346014 GCTCACCTGACCATGGAGGGTGG - Intergenic
1039259661 8:35757518-35757540 GTGCCCCTGACCCAGATGGGAGG - Intronic
1039884128 8:41645847-41645869 GAGCACCTAACCCAGGCTGCAGG - Exonic
1041336112 8:56786189-56786211 GCTCACCTCAGCCATGCGGGAGG + Intergenic
1046979936 8:120326259-120326281 GAGCACCTAACCCAGGCTTGGGG - Intronic
1049283612 8:141762916-141762938 CCGGTCCTGACCCAGGAGGGTGG - Intergenic
1049772725 8:144391213-144391235 GTGCACCTGTGCCAGGCTGGCGG - Exonic
1052740120 9:32384682-32384704 GCGAACCTGACCCAAGCAGCGGG - Exonic
1053157595 9:35791665-35791687 GCGCGCGGGGCCCAGGCGGGGGG + Intergenic
1059394810 9:114027718-114027740 GCTCCCCTGGCCCAGGCAGGTGG - Intronic
1061253451 9:129439793-129439815 GGGCACCTGACTCAGCAGGGAGG + Intergenic
1061798258 9:133100928-133100950 GGGCACCTGACCCAGGGCTGGGG + Intronic
1061898945 9:133663147-133663169 GCTCACCAGGCCCAGGCAGGAGG - Intergenic
1062023732 9:134330954-134330976 CCCCACCTGACCCAGGCAGGAGG - Intronic
1062346330 9:136116995-136117017 CCGCAGCTGACCCTGGGGGGAGG + Exonic
1062488193 9:136791466-136791488 GCTGACCTGAGCGAGGCGGGGGG + Intronic
1062659025 9:137618855-137618877 GCGCACTGGAACCAGGCGTGCGG - Intronic
1189014195 X:37078372-37078394 GCGCACCTGCTACAGCCGGGCGG + Intergenic
1192182518 X:68925165-68925187 GGGCACCTAACCCAGACTGGAGG - Intergenic
1193990848 X:88305246-88305268 CCGCGCCTGGCCGAGGCGGGTGG - Intergenic