ID: 1015916506

View in Genome Browser
Species Human (GRCh38)
Location 6:138222872-138222894
Sequence CTGGAGACTCAGAATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 2, 1: 9, 2: 55, 3: 192, 4: 577}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015916506 Original CRISPR CTGGAGACTCAGAATGGGGG AGG (reversed) Intronic
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
901202843 1:7476372-7476394 AAGGAGACACAGAATGGGCGGGG + Intronic
901234627 1:7661305-7661327 GTGGAGACTCAGGATAGAGGTGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902113353 1:14101141-14101163 CTGGGAACTCAGATTTGGGGAGG - Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903350661 1:22714532-22714554 GTTGAGACTGAGAATGGGAGTGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904233406 1:29096582-29096604 CTGGAAACTTCGAATGAGGGTGG - Intronic
904697326 1:32337634-32337656 CTGTAGTCTCAGGGTGGGGGTGG - Intergenic
904756362 1:32770795-32770817 CTGGTGGCTCAGAAGGGGCGGGG + Exonic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907582569 1:55585096-55585118 CTGGAAACAAAGAATGGGGTGGG - Intergenic
908595038 1:65678937-65678959 TTGGAGACTCAGAATAGGAGAGG - Intergenic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
910393244 1:86765689-86765711 CTGGAGACTAATATAGGGGGAGG - Intergenic
911709120 1:101048895-101048917 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915325701 1:155080354-155080376 CCGGAGTGTCAGACTGGGGGTGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
916059191 1:161087180-161087202 CAGAAGAGCCAGAATGGGGGTGG + Intronic
916415389 1:164587883-164587905 CAGGAGATTCAGAAAAGGGGTGG - Intronic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
918689624 1:187465119-187465141 CTGCAGGGTCAGAATGGTGGAGG + Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918997574 1:191781905-191781927 CAAGAGACTCAGAATAGGGGAGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919613993 1:199782164-199782186 TTGGAGACTGAGAAGAGGGGGGG + Intergenic
919987963 1:202689051-202689073 CAGGAGATTCAGTCTGGGGGCGG - Intronic
920017376 1:202923807-202923829 CTGCTGAATCAGAATGGGAGAGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920990599 1:210935353-210935375 CTAGAGACTGAGAAGGGGAGAGG + Intronic
921534718 1:216332128-216332150 CTAGAGGATCAGAATGGGAGTGG + Intronic
922054153 1:222024067-222024089 CTGAAGACCCACACTGGGGGTGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922323812 1:224510398-224510420 TGGGAGACTCAGAATTGAGGTGG + Intronic
922456149 1:225775211-225775233 CTGGTGACTCCAAAAGGGGGAGG + Intergenic
922461459 1:225817167-225817189 CTGGAGACTCAGGATGGAAGAGG - Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923060644 1:230469827-230469849 GTAGAGACTCAGAAGGGGCGGGG - Intergenic
923085346 1:230698952-230698974 CTGGAGACTCTAAAAAGGGGAGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923561108 1:235042745-235042767 GTGAAGACTCAGAACGGAGGCGG - Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063114816 10:3066562-3066584 CTGGAAAGTCAGAGTGGGGCAGG - Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063414813 10:5864691-5864713 CTGGAGATCCATAATGGGGACGG - Intronic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1066173198 10:32874439-32874461 CTGGAGGCTCAGAAGGGGAGAGG - Intronic
1066374578 10:34846088-34846110 TTGTAGTCTCAGGATGGGGGTGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067182079 10:43995867-43995889 CCGGAGACTCACAAGTGGGGAGG + Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068117055 10:52747039-52747061 CAGCAGACTCAGAATGGAGTGGG - Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068812013 10:61266585-61266607 CAGGAAACTGGGAATGGGGGAGG + Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070027418 10:72645398-72645420 ATGGAGTCTCACAGTGGGGGAGG + Intergenic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070442374 10:76459384-76459406 CTTGGGACTGAAAATGGGGGTGG + Intronic
1071148294 10:82600948-82600970 CTGGAGACTCCAAAAGGGGTGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072872126 10:99131729-99131751 TTGGAGACTCAGAGTTGGAGAGG + Intronic
1073293497 10:102424847-102424869 CTGGAGTCTCAGGATAGGTGGGG - Intronic
1073520212 10:104121672-104121694 CTGGAGCCAGAGAATGGAGGCGG + Intergenic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1075696211 10:124437498-124437520 TTGGAGTCTCAGGATCGGGGAGG - Intergenic
1075761024 10:124856774-124856796 CTGGAGCCTCAGGAAGGGAGGGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076013167 10:127006642-127006664 CTCGAGGCTCAGGATGGGTGCGG + Intronic
1076457445 10:130610443-130610465 CTGGAGCCTGAGGATGGGGCAGG - Intergenic
1076520926 10:131080800-131080822 CTGGAGATTCAGAAATGTGGAGG + Intergenic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1079163341 11:18013651-18013673 CTCGCGACGCTGAATGGGGGAGG + Intergenic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081347353 11:42006591-42006613 CTAGAGACTGAGGATGGAGGTGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083862755 11:65432846-65432868 CTAGAGACTCAAAGTGGGGAGGG - Intergenic
1083865033 11:65449047-65449069 CAGGGGCCTCTGAATGGGGGAGG - Intergenic
1084420759 11:69059387-69059409 GCGGGGACCCAGAATGGGGGAGG + Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084721357 11:70907459-70907481 CAGGAGCCTGAGAAGGGGGGAGG - Intronic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1084898806 11:72294570-72294592 CTGGAGCCTAAGGTTGGGGGAGG - Intronic
1085254998 11:75167513-75167535 CTGGAGAGTCAGAACAGGAGGGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1087260933 11:96011554-96011576 CTGGGGACTCCAAAAGGGGGAGG + Intronic
1087537307 11:99465775-99465797 CTGGAGACTTAAAATTGTGGTGG + Intronic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089140523 11:116280456-116280478 CTGGAGAAGGAGATTGGGGGAGG - Intergenic
1089404757 11:118188246-118188268 CTGAGGACTCAGAAAGGGTGGGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090651199 11:128807692-128807714 CTGGAGACTCCGTATTGGAGAGG + Intronic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091747032 12:2999235-2999257 CTGGGGGCTCAGAATGGGGCTGG - Intronic
1091808620 12:3376485-3376507 CAGGAGACTGAGAGTTGGGGAGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092322983 12:7498313-7498335 TTGTATACTCAGACTGGGGGCGG - Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094474732 12:30832501-30832523 CTGAAGACGCAGAATGGCAGAGG + Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098037934 12:66325360-66325382 CTGGAGACTCAGGCAGGGAGGGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098500105 12:71182168-71182190 TTGGAGACTTAGGATGGGGGAGG + Intronic
1098953161 12:76662635-76662657 CAGGAGTCTCAGAATTGGTGGGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100016319 12:90015136-90015158 GTGTGGACTCAGAATGGGGCAGG + Intergenic
1100637945 12:96453609-96453631 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101068663 12:101049929-101049951 CTGGAGAATAAGAATCTGGGTGG - Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103839852 12:123853609-123853631 CTGTAGTCTCAGGATGGGTGTGG + Intronic
1104394549 12:128421154-128421176 CTAGAGACTCGGAAGGGGAGAGG - Intronic
1104483460 12:129128755-129128777 CTGGAGACTCCCAAGGGTGGGGG - Intronic
1104536616 12:129623432-129623454 TTAGAGACTCAGAAGAGGGGAGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105760561 13:23510190-23510212 CTGGAGACTAAGGATGGAAGGGG + Intergenic
1106070523 13:26406963-26406985 CTGGACAGCCAGAAGGGGGGAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108331284 13:49387191-49387213 TTAAAGACTCAGAATGGGTGTGG - Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108735621 13:53280788-53280810 CTGTAGCATCAGAGTGGGGGAGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111394831 13:87651779-87651801 CTGGGGACTCCAAAGGGGGGAGG - Intergenic
1112137371 13:96596101-96596123 CTGGAGATTCACAAGGGGAGAGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1113116954 13:106884707-106884729 CTGGACACCCAGAGTGGAGGAGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115485480 14:33907562-33907584 CTGGAGAATAAGTATGGGAGTGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116422464 14:44748793-44748815 CTAGAGACTAAGAAGGGTGGGGG + Intergenic
1116693851 14:48147220-48147242 CTGGAGACTCAGAAGGGCAGAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119026351 14:71155901-71155923 CTGGACAATGAGGATGGGGGCGG + Intergenic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120856600 14:89217835-89217857 CTGCAGGCTCAGCATTGGGGAGG - Intronic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121086027 14:91146701-91146723 ATGGAAACTCAGAATGGAAGGGG + Intronic
1121328176 14:93033937-93033959 CTGGGGACTGAGGATGGGGCAGG + Intronic
1121784124 14:96642275-96642297 CTGGAGACTGATAAGTGGGGTGG - Intergenic
1122293533 14:100692611-100692633 CTGGGGACTCAGCCTGGGGCAGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124339267 15:28879506-28879528 CAGGAGGCTGAGAATGAGGGAGG + Intergenic
1125552973 15:40561534-40561556 TTGGAGATTCAGAAGTGGGGAGG + Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126382147 15:48059960-48059982 CTGGAGTCTCAGGACGGGGAGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127052475 15:55099250-55099272 CGGGAGACTCAGAAACGTGGCGG + Intergenic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1129595756 15:76962861-76962883 CTGGGGAGTCAGTATGTGGGTGG - Intergenic
1129710503 15:77818399-77818421 GAGGAGACTCACAATGGGAGAGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130328899 15:82904344-82904366 CTGAAGACTCAGTGTGGGGTAGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134910942 16:18025734-18025756 ATGGAGATTCCGACTGGGGGTGG - Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135632434 16:24046682-24046704 CTGGAGCCTCGGGATGGGGAGGG + Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1135831061 16:25773802-25773824 CGGGAGACTCAGAAGAGAGGAGG - Intronic
1135951835 16:26921537-26921559 AGGGAGCCTCAGAATCGGGGAGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136073792 16:27804799-27804821 GTGGAGGCTGAGATTGGGGGCGG + Intronic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1136580927 16:31150252-31150274 CTGGAGGCCCAGGGTGGGGGTGG + Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1138966697 16:62093298-62093320 CTGGAGACTCCAAAAGGGGGAGG - Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139958213 16:70703385-70703407 CTGGAGACCCACCATGGGGCTGG + Intronic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141824890 16:86472028-86472050 CTGGATGCTCAGGATGGGAGAGG + Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142018508 16:87765598-87765620 GTGGAGACTCAGGAGGGGGCGGG + Intronic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142851567 17:2707206-2707228 CTGGAGTCTCAGGATGGCCGTGG + Intronic
1142885481 17:2909825-2909847 CTGGGGACTCAGACTGGGTGGGG + Intronic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146164217 17:30575502-30575524 CTGGGGACTCAAAATTTGGGGGG + Intergenic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146789502 17:35743377-35743399 ACAGAGACTCAGAATGGGGGTGG - Exonic
1147180857 17:38684776-38684798 CTGGAGACGCAGTCTGGTGGGGG + Intergenic
1147241639 17:39094500-39094522 TTGTAGACTCAGAGTGGGGCCGG - Intronic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148325059 17:46778524-46778546 CAGGAGGCTCAGGGTGGGGGTGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149989270 17:61372201-61372223 GTGCAAACTGAGAATGGGGGCGG - Intronic
1150572757 17:66402057-66402079 CTGGAGAATGAGAATCGGGGTGG + Intronic
1151906033 17:77050127-77050149 CCAGAGGCTCAGAATGGAGGCGG - Intergenic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152240409 17:79157857-79157879 CTGGAGACGCAGCACAGGGGAGG + Intronic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152564679 17:81094982-81095004 GCGGTGACTCAGAGTGGGGGAGG - Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155552107 18:26975432-26975454 ATGGAGACTCGGAGTGGTGGGGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1157695972 18:49723978-49724000 CTGTTGACTGAGAATGTGGGAGG - Intergenic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1160213815 18:76908492-76908514 CTGGAGCCTCAGCATGTGGTGGG + Exonic
1160427586 18:78788511-78788533 CTGGAGACACTGGCTGGGGGAGG + Intergenic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1162575846 19:11498269-11498291 GTGGAGGCTCAGCCTGGGGGAGG - Intronic
1163090291 19:15014711-15014733 CAGGAGACTCAGTGGGGGGGCGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163647511 19:18498193-18498215 TGGGACACTGAGAATGGGGGAGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164489523 19:28693736-28693758 TTGGAGGCTCAGAATAGGCGAGG - Intergenic
1164729599 19:30493008-30493030 CTGCAGACTCAAAATGCTGGCGG - Intronic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164944595 19:32282757-32282779 CTGGAGACTCAAAAGGGGAGAGG - Intergenic
1165329701 19:35134685-35134707 CGGGTGCCTCAGAGTGGGGGTGG - Exonic
1165654435 19:37520831-37520853 CTGGATTCTCAGAATGGTGGTGG + Intronic
1165788759 19:38478215-38478237 GTGGGGAGTCAGGATGGGGGTGG - Intronic
1166069321 19:40378039-40378061 CTGGTGACGCAGAATGGGAGGGG + Exonic
1166317250 19:41996171-41996193 ATGGAGACTGGGAAAGGGGGAGG + Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167609854 19:50501809-50501831 CTGCAGGCACAGAATGGAGGGGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
926099025 2:10101972-10101994 TTGCAGACTGGGAATGGGGGAGG + Intergenic
926685933 2:15697532-15697554 TTGGAGACTCAGACTTGGGTGGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
928064024 2:28145035-28145057 CTTTAGATTCAGAATGTGGGTGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
929575208 2:43047346-43047368 CTGGAGACCCGGAAAGTGGGAGG - Intergenic
930019682 2:46994047-46994069 CTGAATACTCAGAGTGGGGCTGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930539442 2:52686754-52686776 CTGGAGTCTCAGAATGGGGGAGG + Intergenic
930592414 2:53343802-53343824 CTGGAGGCTGAGAATGGAAGGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934165585 2:89291247-89291269 CTGGATTCTCAAAATGGAGGAGG - Intergenic
934201692 2:89891215-89891237 CTGGATTCTCAAAATGGAGGAGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934576603 2:95405688-95405710 CTGGAGACAGGGAATGGTGGAGG + Exonic
934794826 2:97091555-97091577 CTGGAGACAGGGAATGGTGGAGG - Exonic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
934994790 2:98947924-98947946 CTAGACATTCAGAATGGGAGGGG - Intergenic
935125058 2:100215546-100215568 CAGGAGACCCAGACTGGTGGGGG - Intergenic
935476811 2:103532331-103532353 TTGGAGATTCAGAAGTGGGGAGG - Intergenic
935838343 2:107079549-107079571 CGGCAGACTCAAAATGAGGGTGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937971250 2:127551063-127551085 CTGCAGACTGAGGATGGGGTGGG + Intronic
937987059 2:127642676-127642698 CTTGAGACTCAGGAGGCGGGTGG - Intronic
938079707 2:128363176-128363198 CAGGGGACTCAGGAAGGGGGTGG + Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938407717 2:131041758-131041780 CTGGAGACAGAGAAAGGGTGAGG - Intronic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938613359 2:132972080-132972102 CTGGAGAGTAAGAGTGGGTGTGG + Intronic
938948773 2:136238475-136238497 GTGGAGACTGAGAGTAGGGGAGG + Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939182804 2:138823828-138823850 TTGGAGACAAAGAATAGGGGTGG + Intergenic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941762219 2:169256836-169256858 GTGGAAACTCAAGATGGGGGAGG - Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
942491770 2:176496432-176496454 CCGGAGTCTCACAATGGGGGTGG + Intergenic
942736915 2:179125063-179125085 CTGGAGGTTCAGGATGGTGGTGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
948656953 2:239482339-239482361 CTGCAGCCTCAGGATTGGGGGGG - Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169260641 20:4135820-4135842 CTGGTGACTCAGGTAGGGGGAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170075572 20:12415280-12415302 CTGCAGACACAGAATGCTGGAGG - Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171051410 20:21862640-21862662 CTGGTGACTGAGGTTGGGGGAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171509404 20:25668925-25668947 CTGGGGTCTCAGAGTGGAGGTGG - Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172768724 20:37364618-37364640 ATGGAGGCTCAGAAAGGGAGAGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1174943026 20:54952903-54952925 CTGAAAATTCAGAAAGGGGGAGG - Intergenic
1175176596 20:57116080-57116102 CTGGAGCCTGGGAATGCGGGAGG - Intergenic
1175239342 20:57535340-57535362 CTGAAGACCCAGAATTGAGGAGG - Intergenic
1175343785 20:58254523-58254545 CTGAAGACTCAGAAGGGGAGAGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175948276 20:62568826-62568848 CTGGAGGCTCTGACTGGGGTAGG - Intronic
1176023060 20:62972546-62972568 CTTGGGACTCAGCGTGGGGGAGG + Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1177883849 21:26725004-26725026 ATGGAGACTTAGAAGTGGGGAGG - Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1180206980 21:46266829-46266851 CACGAGACTCAGAATGGCTGGGG - Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1182109310 22:27711498-27711520 CTGGGGACTGAGACTGGTGGGGG + Intergenic
1183505577 22:38206966-38206988 CTGGAGAATCAGAGCTGGGGTGG + Intronic
1185107495 22:48882696-48882718 CTGCAGACCCAGCCTGGGGGAGG + Intergenic
950032647 3:9862707-9862729 CTGGAGGCGCTGAATGGGGCCGG + Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950413050 3:12851378-12851400 GTGGAGCCACAGAATGGGGGAGG + Intronic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
951896558 3:27614933-27614955 CTATGGGCTCAGAATGGGGGAGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952913928 3:38216663-38216685 CTGGAGTCTCAGCCTGGAGGAGG - Intronic
953040510 3:39251626-39251648 CTGGAGACTCAAGATGACGGAGG - Intergenic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953328134 3:42029884-42029906 GTGGAGAGCCAGAATAGGGGAGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953598598 3:44340747-44340769 CTGCAGAATCAGAATCTGGGTGG - Intronic
954091498 3:48287912-48287934 CTGGAGAGTGAGGAAGGGGGAGG + Intronic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955767695 3:62362090-62362112 GTGTGGACTGAGAATGGGGGAGG + Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956046091 3:65197471-65197493 CTGGGGAGTCAGGTTGGGGGTGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957651338 3:83009109-83009131 CAGGTGACTCAGGATGGGGCAGG + Intergenic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961243714 3:125433946-125433968 CTGCTGACTCAGAAATGGGGTGG - Intergenic
961716486 3:128861181-128861203 GTGGAGCCACAGAATGCGGGAGG - Intergenic
961805209 3:129484200-129484222 GTGGAGCCACAGAATGGGGGAGG + Intronic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962870463 3:139486151-139486173 CTTGAGACTCAGAAATGGGGAGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966958453 3:184908857-184908879 CTGTGGGCTCAGAATAGGGGAGG + Intronic
967221074 3:187248625-187248647 CTCGAGCCTCAGATTGGAGGAGG + Intronic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
969405212 4:6987116-6987138 CTGGAGACTCCCAAGGGGGCGGG - Intronic
969521097 4:7678156-7678178 CTGGAGACACAGCACAGGGGCGG + Intronic
969521170 4:7678521-7678543 CTGGAGACACAGCACAGGGGCGG + Intronic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
972889456 4:43538363-43538385 CTGGAGATTCAGAAAGGGAGAGG + Intergenic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977223762 4:94370381-94370403 CTGGAGGCTCTGAATGAGGCAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977814002 4:101392265-101392287 TTAGAGACTCAGAAGTGGGGAGG + Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979325953 4:119379719-119379741 TGGGAGACTCAGAAGTGGGGAGG - Intergenic
979663850 4:123289172-123289194 CTGGAGATTCAGAACGGGGTAGG - Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980421556 4:132566707-132566729 CTGGAGACCCAGTTTGGTGGGGG + Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981923287 4:150110639-150110661 TTAGAGACTCAGAAGTGGGGAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983243812 4:165264376-165264398 TGGGAGACTCAGAAGTGGGGAGG - Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985141736 4:186846922-186846944 GTGGAAACTCTGAATGGGGAAGG + Intergenic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985481063 5:111258-111280 CTGCAGACTGAGAATTGGGTAGG - Intergenic
985660995 5:1156371-1156393 CTGGAGTCTGGGGATGGGGGAGG - Intergenic
985717014 5:1468346-1468368 CTGGAGCCTCAGAACGGGCCGGG + Intronic
985717367 5:1470225-1470247 CTGGAGCCTCAGAATAGGCCAGG + Intronic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985963259 5:3319849-3319871 CTGGAGGCCCACAGTGGGGGCGG - Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
988441858 5:31242687-31242709 CTACAGAATAAGAATGGGGGGGG + Intronic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989534024 5:42542788-42542810 CTGGAGACTGAGGAGGGGGTAGG - Intronic
990788459 5:59449801-59449823 GTGGAGATTGGGAATGGGGGTGG - Intronic
990893704 5:60674839-60674861 CTGGAGAAACAAGATGGGGGTGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993195709 5:84742544-84742566 TTGGAGACTCAAAAGTGGGGAGG - Intergenic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
993322757 5:86494319-86494341 CTGGACACTTAGAAGGGTGGAGG - Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
996446506 5:123559174-123559196 TTAGAGACTGAGAATGGGGGAGG + Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997368867 5:133343333-133343355 CTGGACACTCAGCACGGGTGTGG + Intronic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999923577 5:156350069-156350091 TTGGAGACTCAGAAGAGGAGAGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001166415 5:169373297-169373319 TTGGAGACTAAGAAGTGGGGAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001749314 5:174116808-174116830 CAGGAGACTGAGACTGGGAGAGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001938707 5:175726149-175726171 CTGGAGGCTGGGAATGGGAGGGG + Intergenic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004263379 6:14128329-14128351 TTGCATGCTCAGAATGGGGGTGG - Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005394866 6:25370920-25370942 TTGGTGACTCAGAAGAGGGGAGG - Intronic
1005947029 6:30602472-30602494 CTGGCGCCTCGGAATGGAGGAGG + Exonic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006447006 6:34085226-34085248 CTGGAGACTCAAGCTGGTGGAGG + Intronic
1006452248 6:34111960-34111982 CTGGAGATTCTGAAATGGGGAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1007691276 6:43703052-43703074 AGGGAGACTCAGGATGGGTGGGG - Intergenic
1008958269 6:57239634-57239656 CGGGAGGCTCAGGTTGGGGGAGG + Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009514503 6:64597694-64597716 CTGGAGACTTAAAAGGGTGGGGG + Intronic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010706390 6:79116738-79116760 CTGGAATATCAGAATGGGAGGGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014850905 6:126338625-126338647 CTGGAGATTGAGAATGGGGTAGG + Intergenic
1015265904 6:131292324-131292346 ATGGAAACTCAAAGTGGGGGAGG - Intergenic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016622454 6:146128007-146128029 CTGGAACCTCAGAATGTGGCTGG + Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017168942 6:151437741-151437763 CAGGAGATACAGAATGGAGGTGG - Intronic
1017259325 6:152368856-152368878 CTGGAGACCCACACTGTGGGCGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018033965 6:159866395-159866417 CTGGAGTCTGAGCATGGGGAGGG - Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019431352 7:1001250-1001272 CTGTAGGCTCAGCACGGGGGAGG + Intronic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020133729 7:5574493-5574515 GTGGACAGTCAAAATGGGGGAGG - Intergenic
1021008709 7:15434865-15434887 CTAGGGACTGAGAATGGGGTGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022261449 7:28708782-28708804 CTTGGAGCTCAGAATGGGGGTGG + Intronic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1023282620 7:38587046-38587068 CTAGAGATTCAGAATAGGTGTGG - Intronic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1026616136 7:71906376-71906398 CCAGAGACTCCGAATGGGTGGGG + Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032084481 7:128876889-128876911 CTGGTGACTCAACATGGCGGGGG + Exonic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034113575 7:148562466-148562488 CTGGAGACTCAGTCTTGGGGTGG + Intergenic
1035124792 7:156600739-156600761 CTGGAGCCTCGGAAGGGCGGGGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036598382 8:10236281-10236303 CAGGAGAATAAGAATGGGAGAGG + Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039020197 8:33196827-33196849 CTGGAGACTAAGTATGATGGCGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039241746 8:35564751-35564773 CTGGATTCTCAGAAGTGGGGAGG - Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041308691 8:56491418-56491440 CAGGAGACTCAGGCTGGGTGCGG + Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041462735 8:58129733-58129755 CTGGAGACCCTGCATGGGTGTGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042999194 8:74736582-74736604 CTTGAGTCTCAGAATGGGGCTGG + Intronic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046777957 8:118183832-118183854 CTTGAGATTCAGAAGGCGGGAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1047379629 8:124347421-124347443 TTGGAGACTTAGAATGGAAGAGG + Intronic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047704905 8:127488569-127488591 GCTGAGACTCAGAAAGGGGGAGG + Intergenic
1047899866 8:129408413-129408435 CTGGAGATTCAGAAGGGTTGGGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048861986 8:138730351-138730373 CTGGAGACCCAGTATGGCGGTGG + Intronic
1049097795 8:140558983-140559005 CAAGAAACTCAGATTGGGGGGGG - Intronic
1049368390 8:142251862-142251884 CTGAAGACAGAGAATGCGGGCGG - Intronic
1051246623 9:15118149-15118171 CTGCTGAGTCTGAATGGGGGTGG + Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053590596 9:39510669-39510691 GTGGGGACTCAGAATTGTGGGGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053848457 9:42266058-42266080 GTGGGGACTCAGAATTGTGGGGG + Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054575706 9:66854620-66854642 GTGGGGACTCAGAATTGTGGGGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056734646 9:89198431-89198453 TTAGAAACTCAGAATGGGGGAGG + Intergenic
1056753267 9:89366907-89366929 CTTGAGACTAAGAATCTGGGTGG + Intronic
1057977146 9:99618137-99618159 CTGGAGACTCAGAAGAGTAGGGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058402718 9:104636508-104636530 GTGGAGACTCAGAAATGGAGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059973528 9:119692108-119692130 CTGGGGACTCAGAAGAGGAGAGG - Intergenic
1060037044 9:120264492-120264514 TTGGACACTCAGAATAGGGGAGG - Intergenic
1060188094 9:121576028-121576050 CTGGAGACGGAGAGTCGGGGTGG - Intronic
1060648907 9:125307170-125307192 CAGGAGAATCACAGTGGGGGAGG + Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061274159 9:129559770-129559792 CTTGAGGCTCAGCATGGGAGAGG - Intergenic
1061283911 9:129611649-129611671 CTGGAAACTCAGCCTAGGGGTGG - Intronic
1061716873 9:132523892-132523914 CTGGAGCCTGGGAGTGGGGGTGG - Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062604110 9:137336124-137336146 CTGGAGGCTCAGAGGTGGGGAGG + Intronic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186985090 X:15004032-15004054 CTAGAGACAAAGAATAGGGGTGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187551766 X:20313123-20313145 TTGGAAACTCAGAAGAGGGGAGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187660003 X:21534095-21534117 CTGGAGGCTGAGAATGGGAGGGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187964181 X:24594498-24594520 GTGCAGATTCAGAAAGGGGGAGG - Intronic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189507582 X:41627561-41627583 CTAGAGACTCAGAATAGGGGAGG - Intronic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1189817645 X:44839988-44840010 TTGGAGACTCATAATGGGCGAGG + Intergenic
1189903441 X:45733068-45733090 CAAGAGGCTCAGAATGGGAGTGG + Intergenic
1190690382 X:52908677-52908699 GTGGAGACTGGGAACGGGGGAGG + Intergenic
1190695601 X:52947115-52947137 GTGGAGACTGGGAACGGGGGAGG - Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194029789 X:88798386-88798408 CTGGAGACTAGTAGTGGGGGAGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194124694 X:90001459-90001481 CTAGAGGCTTGGAATGGGGGTGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196993408 X:121353777-121353799 CAGGAAACTTAGAATGGTGGTGG - Intergenic
1197339405 X:125247355-125247377 CTGGAGACTTGAAAGGGGGGTGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198036985 X:132810600-132810622 GTGGAGATTCAGAGTGGGAGGGG - Intronic
1198319684 X:135507590-135507612 TTGGCGACTCAGAAGTGGGGAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198740893 X:139841635-139841657 CTGTAGTCTCAGCATGGGGATGG - Intronic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199849553 X:151715629-151715651 CTGGGGACTCTGGATGGGGGAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200477588 Y:3659070-3659092 CTAGAGGCTTGGAATGGGGGTGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1202033491 Y:20605058-20605080 TTGGGGACTCAGAATGTAGGAGG + Intergenic