ID: 1015924020

View in Genome Browser
Species Human (GRCh38)
Location 6:138291930-138291952
Sequence TGTCCATCCAGGACCTCGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015924012_1015924020 -5 Left 1015924012 6:138291912-138291934 CCCCTGTCGTCCAGCCCCTGTCC 0: 1
1: 0
2: 1
3: 34
4: 740
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924013_1015924020 -6 Left 1015924013 6:138291913-138291935 CCCTGTCGTCCAGCCCCTGTCCA 0: 1
1: 0
2: 1
3: 13
4: 251
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924008_1015924020 23 Left 1015924008 6:138291884-138291906 CCGGAGCAGGGGCGCTCCCTGAG 0: 1
1: 0
2: 1
3: 18
4: 260
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924007_1015924020 24 Left 1015924007 6:138291883-138291905 CCCGGAGCAGGGGCGCTCCCTGA 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924014_1015924020 -7 Left 1015924014 6:138291914-138291936 CCTGTCGTCCAGCCCCTGTCCAT 0: 1
1: 0
2: 0
3: 8
4: 168
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924011_1015924020 6 Left 1015924011 6:138291901-138291923 CCTGAGCACGGCCCCTGTCGTCC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1015924010_1015924020 7 Left 1015924010 6:138291900-138291922 CCCTGAGCACGGCCCCTGTCGTC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015924020 Original CRISPR TGTCCATCCAGGACCTCGTC CGG Exonic
901271186 1:7953351-7953373 TGCCCGGCCAGGACCCCGTCTGG + Intergenic
903895052 1:26596968-26596990 TGCCCAGCCACCACCTCGTCTGG + Intergenic
904318175 1:29679561-29679583 TTTCCAGCCAGGAGCTGGTCGGG + Intergenic
906036133 1:42751039-42751061 TGCCCAGCCACGACCCCGTCTGG + Intronic
906792188 1:48668681-48668703 TGTTCATCCAGGACTTGGACTGG + Intronic
907230688 1:52995805-52995827 CGGCCATCCAGGAGCTCTTCAGG + Intronic
908790924 1:67780504-67780526 TGTCTCTCCAGGACCTAGTAAGG + Intronic
912549456 1:110475609-110475631 TGGTCAACCAGGACCTCATCAGG - Intergenic
915861541 1:159449836-159449858 TGCCCAGCCACGACCCCGTCTGG + Intergenic
921142308 1:212320469-212320491 TGTCCAGCCACCACCCCGTCTGG - Intronic
921755786 1:218854588-218854610 TGTCCATCTGAGACCTCATCAGG - Intergenic
921936648 1:220802207-220802229 TGTCCACCCAGGACTCCCTCTGG + Intronic
922102912 1:222488839-222488861 TGCCCAGCCACCACCTCGTCTGG + Intergenic
923022320 1:230174659-230174681 TGTCCCTCCGGGACCTGGACTGG + Intronic
923165834 1:231360769-231360791 TGTCCAGGCAGGACCTCTACTGG - Intergenic
1064218635 10:13420851-13420873 GGTCCAGCCAGGACCTGGCCGGG - Intergenic
1065516235 10:26527082-26527104 TGACCATCCAGGACCAGGTGTGG + Intronic
1069478933 10:68762917-68762939 TGCCTATCCAGGATCTAGTCAGG - Intronic
1070833913 10:79436269-79436291 TGTCCATCCAGAACCCCTCCAGG + Intronic
1071311508 10:84347808-84347830 TGCCCAGCCACGACCCCGTCTGG - Intronic
1072457721 10:95591347-95591369 TGGCCATCCTGGACCTCCTTGGG - Intergenic
1072818815 10:98536102-98536124 TGTCCATGCAGGACTTCCTAAGG - Intronic
1074345566 10:112682676-112682698 TGTTCATCCAGAATCTAGTCTGG - Intronic
1074531284 10:114300534-114300556 TGTCCAGGCAGGACAACGTCGGG + Exonic
1076011791 10:126995036-126995058 TGCCCAGCCACGACCCCGTCTGG - Intronic
1076754558 10:132562461-132562483 TGTGCACCCAGCAGCTCGTCGGG + Intronic
1085073707 11:73571932-73571954 TGCCCAGCCACGACCCCGTCTGG + Intronic
1086366436 11:86111596-86111618 TGCCCAGCCACCACCTCGTCTGG + Intergenic
1091249536 11:134130943-134130965 TGTCCAGCCAGAATCTCTTCAGG - Intronic
1093685336 12:22047606-22047628 GGTCCATCCAGGACTTCTTTTGG - Intronic
1094103598 12:26785923-26785945 TGCCCGGCCAGGACCCCGTCTGG + Intronic
1095930285 12:47618773-47618795 TTTCCATTCAGGACCTGGTCAGG - Intergenic
1098370987 12:69759888-69759910 TGTCCAGCCGCGACCCCGTCTGG - Intronic
1100003636 12:89867620-89867642 TGCCCAGCCACGACCCCGTCTGG - Intergenic
1101877301 12:108604250-108604272 TGTCCATGCAGGAGCTGGTGTGG - Intergenic
1109890261 13:68602517-68602539 TTTCCATCTGGGACCTGGTCAGG - Intergenic
1110229312 13:73152207-73152229 AGTCCATCCAGGAGCTCATGTGG + Intergenic
1114175040 14:20310745-20310767 TGCCCAGCCACCACCTCGTCTGG + Intergenic
1114199520 14:20507084-20507106 TGCCCGGCCAGGACCCCGTCTGG + Intronic
1119617310 14:76107386-76107408 TGCCCATCAAAGACCTCCTCCGG + Intergenic
1119711040 14:76822192-76822214 TGCCCAGCCACCACCTCGTCTGG + Intronic
1121243974 14:92449637-92449659 TCTCCATCCAGGACTGGGTCTGG - Intronic
1122034005 14:98934423-98934445 TGTCCATGCAGCACCTTCTCCGG + Intergenic
1125760510 15:42093062-42093084 TGGCCATCCGGGACCTGTTCTGG - Intronic
1129431862 15:75504931-75504953 TGCCCAGCCACCACCTCGTCTGG + Intronic
1132036928 15:98492919-98492941 TGCCCAGCCACCACCTCGTCTGG - Intronic
1134854318 16:17506085-17506107 TGCCCAGCCAAGACCCCGTCTGG - Intergenic
1147894287 17:43740335-43740357 TTCCCACCCAGGACCTCCTCAGG + Intergenic
1148509133 17:48153828-48153850 TGTCCATTTAGGACTTCCTCAGG - Intronic
1151964970 17:77426389-77426411 TCTCCATCCAGGAGCTCACCGGG - Intronic
1155575325 18:27239384-27239406 TGTCCATCCAGAAAATGGTCAGG + Intergenic
1159431944 18:68363163-68363185 TGTCCCTCCTGGGCCTCGTTTGG - Intergenic
1160585863 18:79913049-79913071 TGTCCAGCCAGGACATGGGCTGG - Intronic
1160717133 19:581573-581595 TCACCATCCAGGACGTCCTCGGG - Exonic
1160740151 19:681848-681870 AGTCCTTCCAGGATATCGTCAGG - Exonic
1162893488 19:13750525-13750547 TATCCATCAAAGACCTCATCCGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1166384241 19:42371291-42371313 TGTCCATCCTGGACCACTGCAGG + Intronic
925045728 2:771740-771762 TGTCCACCCAGGAGCCCGTGTGG - Intergenic
925289601 2:2738575-2738597 TGTCCAGCCTGGTCCTTGTCAGG - Intergenic
925310686 2:2879355-2879377 TGTCCATCCAGGCCCCAGGCTGG - Intergenic
925685969 2:6473989-6474011 TTTCCATCCAGGAATTCCTCTGG + Intergenic
926341723 2:11909624-11909646 TGTCCATGCAGTAGCTCATCCGG - Intergenic
932591501 2:73070724-73070746 TTTCCCTCCGGGACCTCCTCTGG - Intronic
933375102 2:81468999-81469021 TGACCATCCAGGACCCCATCTGG + Intergenic
933969328 2:87457426-87457448 TCTCCATCCAGGCCCTGTTCCGG - Intergenic
936324459 2:111493068-111493090 TCTCCATCCAGGCCCTGTTCCGG + Intergenic
941769327 2:169328381-169328403 TGCCCAGCCACCACCTCGTCTGG + Intronic
948262221 2:236612892-236612914 TGTCCATCCAGCACCTGGCTCGG + Intergenic
1169195298 20:3679523-3679545 TGTCCATCCAGGACCCAGTGCGG + Exonic
1171108926 20:22462664-22462686 TGTCCTTCCATGCCCTCCTCCGG + Intergenic
1171188418 20:23140578-23140600 TGTCCATCCTGGACAAAGTCTGG + Intergenic
1176335053 21:5588787-5588809 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176392704 21:6232161-6232183 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176468715 21:7084013-7084035 TGTTCACTCAGGACATCGTCAGG - Intronic
1176492276 21:7465791-7465813 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176508366 21:7672592-7672614 TGTTCACTCAGGACATCGTCAGG + Intergenic
1178404686 21:32314649-32314671 GGCCCATCCAGTGCCTCGTCAGG - Exonic
1181516107 22:23414748-23414770 TGCCCCTCCAGGACCTCCTTGGG - Intergenic
1182430381 22:30295500-30295522 TGTCCAGCCTGGCCCTCTTCCGG - Intronic
1182807055 22:33081720-33081742 TGTCTATCCAGAACCTAGACTGG + Intergenic
1184715962 22:46281960-46281982 TGTCCTTACAGGGCCTGGTCAGG + Intronic
954289275 3:49640826-49640848 TTTCCCACCAGGACCTCCTCTGG - Intronic
954566891 3:51607629-51607651 TGCCCATCCACCACCCCGTCTGG - Intronic
963498617 3:146097269-146097291 TGCCCAGCCACGACCCCGTCTGG + Intronic
970294173 4:14610646-14610668 TGTCCTCCCAGGACATCATCTGG + Intergenic
970409645 4:15791895-15791917 TGCCCGGCCAGGACCCCGTCTGG + Intronic
974661828 4:64900292-64900314 TGCCCAGCCACCACCTCGTCTGG + Intergenic
976265537 4:83185129-83185151 TGCCCAGCCACGACCCCGTCTGG - Intergenic
977089445 4:92652030-92652052 TGTGCATTCAGGGCCTCCTCAGG + Intronic
978735385 4:112078192-112078214 TGGCCATCCAGGAGCTGTTCAGG + Intergenic
979702516 4:123685037-123685059 TGCCCAGCCACGACCCCGTCTGG + Intergenic
984146116 4:176063828-176063850 TGTACTTCCAGGTCCTCGGCAGG - Intergenic
988110047 5:26807930-26807952 GGTCCAGCCACCACCTCGTCAGG + Intergenic
989828843 5:45890616-45890638 TGCCCAGCCACGACCCCGTCTGG + Intergenic
990458797 5:56014444-56014466 TGCCCAGCCACCACCTCGTCTGG - Intergenic
993514389 5:88812754-88812776 AGTCCATCCAGGAACAAGTCTGG - Intronic
999245759 5:150153812-150153834 TGCCCTTCCAGGACATCGTGTGG - Intronic
999839587 5:155411018-155411040 TCTCCATCCAGGCCCTTGGCAGG + Intergenic
1003319237 6:5037533-5037555 TGCCCGGCCAGGACCCCGTCTGG - Intergenic
1005331333 6:24753317-24753339 TGTCCATTCAGGACCTCTGTGGG - Intergenic
1006064487 6:31454271-31454293 TGCCCAGCCACCACCTCGTCTGG - Intergenic
1006826820 6:36941661-36941683 TGCCCAGCCACGACCCCGTCTGG + Intergenic
1007076716 6:39073022-39073044 GGTGCATCCAGGACCGCCTCAGG + Intronic
1008127180 6:47681953-47681975 TGTCCATTGAGGTCCTAGTCTGG + Exonic
1015924020 6:138291930-138291952 TGTCCATCCAGGACCTCGTCCGG + Exonic
1016418375 6:143857292-143857314 TTTCCTTCTAGGACCTCGACTGG + Exonic
1017557051 6:155583042-155583064 TGTCCCTCCAGAGCCTCCTCCGG - Intergenic
1022663397 7:32387398-32387420 TGCCCGGCCAGGACCCCGTCTGG - Intergenic
1024654147 7:51434875-51434897 TGTCCCTTCAGGACCTGGCCGGG + Intergenic
1029334626 7:99888565-99888587 TGCCCAGCCACGACCCCGTCTGG - Intronic
1029568911 7:101358521-101358543 TGCCCAGCCACCACCTCGTCTGG - Intergenic
1030602993 7:111610625-111610647 TGCCCAGCCACCACCTCGTCTGG + Intergenic
1032662108 7:133995798-133995820 TGTCTATCCAGGCCCTTTTCTGG + Intronic
1035226054 7:157432778-157432800 TGTCCATCCTGAGCCTCGTGAGG + Intergenic
1036659347 8:10697982-10698004 TGTCTCTCCAGGACCTGGCCGGG - Exonic
1039417962 8:37411783-37411805 TGTCTCTCCATGACCTGGTCTGG - Intergenic
1039513618 8:38111935-38111957 TCTCCATCCAGGATCTGGTCAGG + Intronic
1040819032 8:51535188-51535210 TGCCCGGCCAGGACCCCGTCTGG + Intronic
1047521600 8:125599261-125599283 TGTCAATCCAGGAACACATCAGG - Intergenic
1047575697 8:126152259-126152281 TGTTCATCCAAGAGCTAGTCTGG - Intergenic
1060703465 9:125779783-125779805 TGCCCAGCCACCACCTCGTCTGG - Intronic
1061203703 9:129151177-129151199 TGTCCATCCTGGAGCTCCTGTGG - Intergenic
1062066974 9:134533878-134533900 TGTCTACCCAGGACCACGTCCGG - Intergenic
1203562602 Un_KI270744v1:71455-71477 TGCCCAGCCATGACCCCGTCTGG + Intergenic
1186575404 X:10760147-10760169 TGACTATCCAGGACATTGTCAGG - Intronic
1199985594 X:152947789-152947811 TGTCCAGCCAGGCCCTTGGCTGG + Intronic