ID: 1015926048

View in Genome Browser
Species Human (GRCh38)
Location 6:138311489-138311511
Sequence TTACCTCAGGCGCTGCTCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 172}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015926033_1015926048 18 Left 1015926033 6:138311448-138311470 CCCGGAGCCCCGTCCACAGACCT 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926041_1015926048 -2 Left 1015926041 6:138311468-138311490 CCTGTGCCTCCCGGCCCTGGATT 0: 1
1: 0
2: 2
3: 22
4: 173
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926039_1015926048 5 Left 1015926039 6:138311461-138311483 CCACAGACCTGTGCCTCCCGGCC 0: 1
1: 1
2: 0
3: 33
4: 514
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926032_1015926048 24 Left 1015926032 6:138311442-138311464 CCAGCACCCGGAGCCCCGTCCAC 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926037_1015926048 9 Left 1015926037 6:138311457-138311479 CCGTCCACAGACCTGTGCCTCCC 0: 1
1: 0
2: 7
3: 57
4: 767
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926042_1015926048 -8 Left 1015926042 6:138311474-138311496 CCTCCCGGCCCTGGATTACCTCA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926031_1015926048 25 Left 1015926031 6:138311441-138311463 CCCAGCACCCGGAGCCCCGTCCA 0: 1
1: 1
2: 2
3: 10
4: 128
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926035_1015926048 11 Left 1015926035 6:138311455-138311477 CCCCGTCCACAGACCTGTGCCTC 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926036_1015926048 10 Left 1015926036 6:138311456-138311478 CCCGTCCACAGACCTGTGCCTCC 0: 1
1: 0
2: 1
3: 37
4: 333
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926030_1015926048 26 Left 1015926030 6:138311440-138311462 CCCCAGCACCCGGAGCCCCGTCC 0: 1
1: 1
2: 6
3: 25
4: 274
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172
1015926034_1015926048 17 Left 1015926034 6:138311449-138311471 CCGGAGCCCCGTCCACAGACCTG 0: 1
1: 0
2: 1
3: 23
4: 275
Right 1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG 0: 1
1: 0
2: 0
3: 27
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015926048 Original CRISPR TTACCTCAGGCGCTGCTCTC AGG Exonic
902212419 1:14913551-14913573 TCACCTTAGGCCCTGGTCTCTGG - Intronic
902803548 1:18846497-18846519 TTGTCTCAGGCTCTGCTTTCTGG + Intronic
903813962 1:26051072-26051094 TTGCCTCAGGCTCTGTTTTCTGG + Intergenic
904536829 1:31204923-31204945 TCAGCTCAGGCTCTGCACTCGGG + Intronic
904661686 1:32090273-32090295 TTAGCTCCAGCCCTGCTCTCAGG + Intronic
904997195 1:34640318-34640340 TGACCTCAGGCACTGCTGTCTGG + Intergenic
905037636 1:34928474-34928496 CTACCTCAGGGGGTGCCCTCTGG - Intronic
908036430 1:60059350-60059372 TGACCTCAGCTGCTGCTCTGGGG + Intronic
908848177 1:68346270-68346292 TTGTCTCAGGCACTGCTTTCTGG + Intergenic
909975077 1:82036518-82036540 TTGTCTCAGGCTCTGCTTTCTGG - Intergenic
910738955 1:90494522-90494544 TTACCACAGCTGATGCTCTCTGG - Intergenic
912730936 1:112103000-112103022 TGAACTCAGACTCTGCTCTCAGG - Intergenic
912775685 1:112505044-112505066 TCACCTTATGCTCTGCTCTCTGG - Intronic
916452616 1:164935649-164935671 TTGCCTCAGGCTCTGCTTCCTGG - Intergenic
917045741 1:170858172-170858194 TTGCCTCAGGCTTTGCTCTTTGG + Intergenic
917451624 1:175152083-175152105 TTACCTCAAGCGCTTCGCTAGGG + Intergenic
918111660 1:181460063-181460085 TTGCCTCAGGCTCTGCTTTCTGG + Intronic
920759065 1:208764001-208764023 TTATTTCAGGCTCTGCTCTTTGG + Intergenic
924321382 1:242854652-242854674 TTACCACAGCTGATGCTCTCTGG - Intergenic
1063149712 10:3325095-3325117 GTGCCTCAGCAGCTGCTCTCTGG + Intergenic
1063904027 10:10764916-10764938 TTATCTCAGGCTTTGCTTTCTGG - Intergenic
1064908106 10:20370016-20370038 TTACCACAGCTGATGCTCTCCGG - Intergenic
1064991131 10:21257998-21258020 TTATCTCAGGCCCTGCTCTTGGG - Intergenic
1067098101 10:43315515-43315537 TTAGCTCAGGCGCTGCTGGGTGG - Intergenic
1069855040 10:71435578-71435600 TTACCTCTGGAGCAGGTCTCTGG + Intronic
1071357589 10:84813257-84813279 ATACCTCAAGCGCTGATCTTAGG + Intergenic
1072174645 10:92907096-92907118 TTACCTCAGACTCTGCTTTCTGG - Intronic
1075391587 10:122096337-122096359 TTGCCACAAGCGCTGCTGTCAGG - Intronic
1075825025 10:125348732-125348754 TTGCCTCAGGCTCTGCTTCCAGG - Intergenic
1075974845 10:126686126-126686148 TTTTCTCAGGCTCTGCTGTCAGG + Intergenic
1076937238 10:133574716-133574738 TGGCCTCAGGCTCTGCTCTGAGG + Intergenic
1076997699 11:307000-307022 TAACCTCAGGAGCTGCTCAGAGG + Intergenic
1077278771 11:1732560-1732582 TCAGCTCCGGCGCTGGTCTCTGG - Exonic
1077551523 11:3202605-3202627 TGACCCCACGCTCTGCTCTCAGG + Intergenic
1077879608 11:6338474-6338496 TTAGCTCATGCACTGCTCCCAGG - Intergenic
1079967297 11:26994703-26994725 TGACCACAGGCGCTGCTCCCAGG + Exonic
1083708371 11:64532023-64532045 TTGCCACAGGCCCTGCTCACAGG + Intergenic
1083951665 11:65959923-65959945 TTATCTCAGGGACTGCACTCCGG - Exonic
1086336565 11:85806992-85807014 TTGCCTCAAGGACTGCTCTCAGG - Intronic
1087889173 11:103517388-103517410 TTGCCTCAGGCTCTGCTTTCTGG - Intergenic
1089623330 11:119735359-119735381 TCACCTCAGGCAGTGCTCCCAGG + Intergenic
1089652811 11:119925727-119925749 GTATCTCAGGCTCTGCTTTCTGG - Intergenic
1090003953 11:122984200-122984222 TCTCCCCAGGCCCTGCTCTCAGG + Intergenic
1091138113 11:133211196-133211218 TTCCCTCAGGTTCTGCTTTCTGG + Intronic
1092411760 12:8258327-8258349 TTGCCTCAGGCTCTGCTTTTAGG + Intergenic
1092524813 12:9303240-9303262 TTATTTCAGGCGCTGCTCTGGGG + Intergenic
1092542453 12:9428579-9428601 TTATTTCAGGCGCTGCTCTGGGG - Intergenic
1094510560 12:31093858-31093880 TTATTTCAGGCCCTGCTCTGGGG + Intronic
1095659114 12:44708394-44708416 TCATCTCATGCTCTGCTCTCAGG + Intronic
1095924094 12:47561242-47561264 TTGCCTCAGACGCTGAGCTCCGG - Intergenic
1096402947 12:51322683-51322705 TTCCCATAGGCCCTGCTCTCGGG + Intronic
1096985788 12:55756128-55756150 TTACCTCAGGCTCTGATCTTGGG - Exonic
1098570578 12:71983264-71983286 TTGCCTCAGGCACTGCTCAAAGG - Intronic
1098977748 12:76920831-76920853 TTGTCTCAGGCTCTGCTTTCAGG + Intergenic
1102595947 12:113992707-113992729 TTGCCTCAAGCTCTGCTTTCAGG - Intergenic
1105892969 13:24695236-24695258 TCACCCCAGGGGCTGCTCACCGG - Intronic
1106164539 13:27231295-27231317 ATACCTCAAGCACTGATCTCAGG + Intergenic
1108182882 13:47858318-47858340 TTGCCTCAGGCTCTGCTTTCTGG + Intergenic
1108480582 13:50866208-50866230 TCACCTAATGCGCGGCTCTCTGG - Intergenic
1112907997 13:104447503-104447525 GTGCCTCAGGCTCTGCTTTCAGG + Intergenic
1113047966 13:106176370-106176392 TTATGTCAGGCACTGCCCTCAGG + Intergenic
1115265201 14:31493269-31493291 TTACCACAGCTGATGCTCTCTGG + Intronic
1115835462 14:37397490-37397512 TTACCACAGCTGATGCTCTCTGG - Intronic
1116013683 14:39380978-39381000 TTACCACAGGGGCTGCTCTTGGG - Intronic
1116684503 14:48020201-48020223 TTATCTCAGGTTCTGCTTTCAGG - Intergenic
1117813072 14:59568995-59569017 TTGCCTCAGGCTCTGCTTTTTGG + Intronic
1119667311 14:76494082-76494104 TTGCCTCAGGCTCTGCTCCCAGG + Intronic
1120267454 14:82269514-82269536 TTGTCTCAGGCACTGTTCTCAGG - Intergenic
1121419934 14:93806169-93806191 TTGCCTCAGGCTCTACTTTCAGG - Intergenic
1122937275 14:104966069-104966091 TCCCCTCTGGCTCTGCTCTCAGG + Intronic
1124339342 15:28879896-28879918 TCCCCTCTGGCTCTGCTCTCTGG + Intergenic
1126497827 15:49312086-49312108 TTATCTCAAGCTCTACTCTCAGG + Intronic
1129002933 15:72348979-72349001 TTAGCTCAGCTGCTGCTCTCAGG - Intronic
1129103914 15:73292066-73292088 TTCCCTCAGGTGCTGCTCTTGGG - Intronic
1131428764 15:92369062-92369084 TTCCTTCAGGCTCTGCTCTATGG + Intergenic
1131663049 15:94539136-94539158 TCACCTCCTGAGCTGCTCTCTGG - Intergenic
1132362072 15:101224765-101224787 TCACCTCAGGCGGTGTTGTCTGG - Intronic
1132717495 16:1299227-1299249 TTGCCTCAGGCTCTGCTCCGGGG + Intergenic
1135604274 16:23809595-23809617 TTATCTCAAGCTCTGCTCTTTGG + Intergenic
1136746764 16:32597658-32597680 TTAGCTCAGGCAGTGCCCTCTGG - Intergenic
1137765466 16:50974486-50974508 TTGTCTCAGGCTCTGCTTTCGGG - Intergenic
1138295351 16:55880515-55880537 CTGCCTCAGGCTCTGCTTTCAGG + Intronic
1138328168 16:56192139-56192161 TGAGCCCAGGCTCTGCTCTCTGG + Exonic
1139485289 16:67252797-67252819 TCACAACAGGCGCTGCCCTCTGG + Exonic
1141319494 16:82994037-82994059 TTCCCTCTGGTGCTGGTCTCAGG + Intronic
1141944300 16:87298896-87298918 TTGCCTCAGGCTCTGCTTTTGGG - Intronic
1141963348 16:87424330-87424352 TGAGCCCAGGCCCTGCTCTCAGG + Intronic
1203048893 16_KI270728v1_random:856862-856884 TTAGCTCAGGCAGTGCCCTCTGG - Intergenic
1143032629 17:3976408-3976430 TCACCTCAGGGGGTGCTCCCAGG + Intergenic
1144100788 17:11940499-11940521 CTACCCCAGCAGCTGCTCTCAGG + Intronic
1147635645 17:41962254-41962276 CCACCTGCGGCGCTGCTCTCGGG + Intronic
1150354450 17:64471127-64471149 TTATTTCAGGCTCTGCTTTCAGG - Intergenic
1152026457 17:77812583-77812605 ATACCCCAGTGGCTGCTCTCTGG - Intergenic
1153187684 18:2502832-2502854 TTGTCTCAGACTCTGCTCTCAGG + Intergenic
1153408693 18:4769596-4769618 TTGCCTCAGGCTCTGTTTTCTGG - Intergenic
1154340794 18:13500480-13500502 CTCCCACAGGCGCTGCTCCCAGG - Intronic
1155906527 18:31458740-31458762 TTCCCTCAGGCGAGGCTCTGTGG - Intronic
1158888156 18:61848641-61848663 TTTCCACAGGTGCTGGTCTCTGG - Intronic
1158993694 18:62895637-62895659 TTGCCTCAGGCCCTGCCCTTAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1163869120 19:19803403-19803425 TTACCTGAGGAAATGCTCTCTGG + Intronic
1163925129 19:20333674-20333696 TTACCTGAGGAAATGCTCTCTGG - Intergenic
1163941440 19:20498619-20498641 TTACCTGAGGAAATGCTCTCTGG - Intergenic
1163956265 19:20644224-20644246 TTACCTGAGGAAATGCTCTCTGG + Intronic
1163974485 19:20837000-20837022 TTACCTGAGGAAATGCTCTCTGG + Intronic
1164738772 19:30561473-30561495 TTACCTCAGGATCTGCTCTAGGG - Intronic
1165066406 19:33231473-33231495 TTGCCCCAGGCACTGCTTTCTGG + Intergenic
1166893677 19:46009779-46009801 TATCCTCAGGATCTGCTCTCAGG + Intronic
925736402 2:6967758-6967780 TTGTCTCAGGCTCTGCTCTTGGG + Intronic
928076469 2:28269478-28269500 TTAGCTCAGCAGCTGCACTCTGG + Intronic
937941866 2:127292453-127292475 TTACCCCAGCCGCTACACTCTGG - Intronic
943956656 2:194200436-194200458 ATATCTCAAGCACTGCTCTCAGG - Intergenic
945825675 2:214717317-214717339 TTACCACAGCTGATGCTCTCTGG + Intergenic
948051875 2:234984777-234984799 TTGTCTCAGGCTCTGCTTTCAGG - Intronic
949060304 2:241953117-241953139 GTATCTCAGGCGCTGCTTCCCGG - Intergenic
1170667587 20:18400160-18400182 TTATCTCAGGTTCTGCTTTCAGG - Intronic
1172635261 20:36405876-36405898 TTACCTTGGGCCCTGCTCTTGGG - Intronic
1172815875 20:37685506-37685528 TTACCTAGGGCACTGCTCCCAGG - Intergenic
1176990511 21:15490901-15490923 TTACCTCCGGTGCTGCTTTGGGG - Intergenic
1177342734 21:19825947-19825969 TTTCCTCAGGCTCTCCTCTCTGG + Intergenic
1182504500 22:30772142-30772164 TGGCCTCAGGCACTGCCCTCTGG + Intronic
1185405160 22:50643609-50643631 ATACCTCAAGCGCTGATCTTAGG + Intergenic
949938333 3:9134805-9134827 TGACCTCAGGCCCTCCTCTGAGG + Intronic
952686027 3:36149330-36149352 TTATCTCAGGCTCTGATTTCAGG - Intergenic
958178365 3:90025061-90025083 TTTCCTCAAGGGCTTCTCTCAGG + Intergenic
960718611 3:120603306-120603328 TTCCCTCAGTCTCTGCTTTCTGG - Intergenic
960738412 3:120805407-120805429 GTATCTCAGGCTCAGCTCTCAGG - Intergenic
962144295 3:132823706-132823728 TTGCCTCAGGCTCTGCTTTGGGG + Intergenic
962361675 3:134748298-134748320 TTGTCTCAGGCTCTGCTTTCAGG + Intronic
964197527 3:154081882-154081904 TTGCCTCAGGCTCTGCTTCCTGG + Intergenic
965952743 3:174330533-174330555 TTACCCCAGCTGCTGCACTCTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967828443 3:193897776-193897798 TTACCTCAGGCCATCCTCTTTGG - Intergenic
968497122 4:924899-924921 TTCCCCCAGGGGCTGCTCTCAGG + Intronic
971813605 4:31459686-31459708 TTGTCTCAGGCTCTGCTCTGGGG + Intergenic
974346438 4:60688136-60688158 TTACCTCAGGCCAGGCTGTCTGG + Intergenic
980459998 4:133097144-133097166 TGACCTCAGGTTCTGCTCCCTGG + Intergenic
982491781 4:156038885-156038907 CTACCACAGCTGCTGCTCTCTGG + Intergenic
984181158 4:176484178-176484200 TTTCCTCAGGCCCTGTTTTCTGG - Intergenic
986145245 5:5071665-5071687 TCACCCCAGGCTCTGCTCTATGG + Intergenic
986767083 5:10938012-10938034 GGAACTCAGGCTCTGCTCTCTGG + Intergenic
989497540 5:42126313-42126335 TTACCTCAGGCTCTGCTTCTAGG - Intergenic
995360414 5:111290345-111290367 TTGCCTCAGGCTCTAATCTCTGG - Intronic
995955197 5:117769219-117769241 TTCCCTCAGGGGGTCCTCTCAGG - Intergenic
997207663 5:132059540-132059562 TTCTCTCAGGGGCTGCCCTCTGG + Intergenic
997390762 5:133513155-133513177 TTAGCAAAGGCGCAGCTCTCTGG - Intronic
997580878 5:135016132-135016154 TTATCTCAGGCCCTGATCCCAGG - Intergenic
1000137236 5:158364666-158364688 TTATCTCAGGCCCTGCTCTTGGG + Intergenic
1000779686 5:165465172-165465194 TTACCACAGCCGGTGCTCTCTGG + Intergenic
1001986223 5:176076027-176076049 TTAGCTCAGGCAGTGCCCTCTGG - Intronic
1002230644 5:177762097-177762119 TTAGCTCAGGCAGTGCCCTCTGG + Intronic
1002264690 5:178021651-178021673 TTAGCTCAGGCAGTGCCCTCTGG - Intronic
1003393007 6:5729408-5729430 TGTCCTCAGCCCCTGCTCTCTGG - Intronic
1014886954 6:126793541-126793563 TTGCCTCAGGCTCTGCTTTCTGG - Intergenic
1015150705 6:130033607-130033629 TGACACCAGGCGCTGATCTCAGG + Intronic
1015926048 6:138311489-138311511 TTACCTCAGGCGCTGCTCTCAGG + Exonic
1016278313 6:142380827-142380849 TAAGCTAAGTCGCTGCTCTCAGG - Intronic
1016841315 6:148528439-148528461 TTTGCTCAGCTGCTGCTCTCTGG + Intronic
1021141195 7:17027917-17027939 TTGCCTCAGGCTCTGCTTTCTGG - Intergenic
1029705503 7:102273751-102273773 TTGCCTCTGCCTCTGCTCTCAGG - Intronic
1030007775 7:105135432-105135454 TTCCCTCTGCTGCTGCTCTCTGG - Intronic
1030130208 7:106193544-106193566 TTGTCTCAGGCTCTGCTTTCAGG - Intergenic
1032522011 7:132552640-132552662 TTACCCGAGCCGCTGCTCACTGG + Intronic
1032815058 7:135465112-135465134 TTTCCTAAGCTGCTGCTCTCTGG + Intronic
1034101275 7:148452535-148452557 TTATCTCAGGCTCTGGTTTCTGG + Intergenic
1034281058 7:149854741-149854763 TCAGCCCAGGAGCTGCTCTCAGG + Intronic
1036047607 8:5161105-5161127 TTACCTTAGCTGCTGCTTTCTGG + Intergenic
1037346068 8:17902760-17902782 TTGTCTCAGGCTCTGCTTTCAGG - Intronic
1038711722 8:29953128-29953150 TTGCCTCAAGCTCTGCTTTCAGG - Intergenic
1039095513 8:33880725-33880747 TTACCACAGCTGATGCTCTCTGG - Intergenic
1042210534 8:66376228-66376250 TCACCCCAGACGCTGCTCTGTGG + Intergenic
1042210602 8:66376741-66376763 TCACCCCAGACGCTGCTCTGTGG + Intergenic
1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG + Intergenic
1046906467 8:119578977-119578999 ATAACTCAAGCGATGCTCTCAGG + Intronic
1049026471 8:139994115-139994137 TTTTCTCAGGCTCTGCTTTCTGG - Intronic
1049080521 8:140439675-140439697 GCACCCCAGGCCCTGCTCTCTGG - Intronic
1049230868 8:141480494-141480516 GAATCTCAGGCCCTGCTCTCAGG - Intergenic
1049581072 8:143411280-143411302 TGACGTCAGGCGCAGGTCTCAGG - Intergenic
1050879203 9:10678093-10678115 TTTCTTCAGGCTATGCTCTCTGG - Intergenic
1053210147 9:36220642-36220664 TTGTCTCAGGCTCTGCTCTGAGG + Intronic
1056998599 9:91487264-91487286 TAACTTCAGGCCCTTCTCTCAGG + Intergenic
1058132739 9:101271291-101271313 TTACCTCATGCGTTGCTGTGGGG + Intronic
1058750851 9:108037163-108037185 TTATCTCAGGCCGTGCTTTCTGG - Intergenic
1060806245 9:126579125-126579147 TTGCCTCAGGCCCTGCTTTCTGG + Intergenic
1061382077 9:130264813-130264835 TTATCTCAGGCTGTGCTCTCGGG - Intergenic
1062043171 9:134413489-134413511 TGGCCTCTGGCGCTGCTCTCTGG + Intronic
1062447220 9:136600010-136600032 TTGTCTCAGGCCCTGCTCTTTGG + Intergenic
1186311531 X:8324618-8324640 TTATCTCAGGCTCTGCTCCCAGG - Intergenic
1187479284 X:19640273-19640295 TTACATGAGGCGCTGCACTTGGG - Intronic
1187775308 X:22749986-22750008 TTATCTCAGGCTCTCCTTTCAGG - Intergenic
1188793006 X:34426717-34426739 TTGTCTCAGGCTCTGCTTTCTGG + Intergenic
1191881278 X:65845793-65845815 TGACCACAGGCCTTGCTCTCAGG - Intergenic
1192452245 X:71251754-71251776 TTACCTCAGGCTCTGTACTAAGG + Intronic
1193087323 X:77458422-77458444 ATACCTCAGGGGCTGCTCTGGGG - Intergenic
1195369895 X:104163332-104163354 TTACCCCAGGGTTTGCTCTCAGG + Intergenic
1196172236 X:112602317-112602339 TTTCCTCAGGCTCTGCTTTCCGG - Intergenic
1196326814 X:114415106-114415128 TTGCCTCAGACTTTGCTCTCTGG - Intergenic
1197306695 X:124851194-124851216 TGACCTCAGTCTCTGATCTCAGG - Intronic
1197518947 X:127473316-127473338 CTACCACAGGTGATGCTCTCTGG + Intergenic
1198482406 X:137052839-137052861 CTATCGCAGGCGCTGTTCTCTGG - Intergenic