ID: 1015926899

View in Genome Browser
Species Human (GRCh38)
Location 6:138319835-138319857
Sequence GTGCTCCACCACCAGCTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015926899_1015926901 30 Left 1015926899 6:138319835-138319857 CCTGTGAGCTGGTGGTGGAGCAC 0: 1
1: 1
2: 1
3: 21
4: 152
Right 1015926901 6:138319888-138319910 AGTGCCAGAGCAGTTCATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 143
1015926899_1015926900 0 Left 1015926899 6:138319835-138319857 CCTGTGAGCTGGTGGTGGAGCAC 0: 1
1: 1
2: 1
3: 21
4: 152
Right 1015926900 6:138319858-138319880 ATTCAAAGCTTTCTACATTCAGG 0: 1
1: 0
2: 4
3: 32
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015926899 Original CRISPR GTGCTCCACCACCAGCTCAC AGG (reversed) Exonic
900431662 1:2605737-2605759 AAGCTCCACCACCAGCTCCTGGG - Intronic
901824613 1:11852842-11852864 GTGCTCAACCAACATCTGACAGG - Intergenic
901878023 1:12178057-12178079 CTCCTCCACCACCACCTCATTGG - Intronic
901882408 1:12202038-12202060 GAGCTCCAGCAGCAGCTCCCTGG + Exonic
902891519 1:19447712-19447734 GCCCTCCTCCACCAGCTCCCAGG - Intronic
904410533 1:30322232-30322254 GAGCCTCCCCACCAGCTCACAGG - Intergenic
905196687 1:36284793-36284815 GTGATCCACCACCAGCACTAAGG - Intronic
905473981 1:38213050-38213072 GGGCTCCACCACATGCCCACTGG - Intergenic
906797719 1:48711104-48711126 GTGATCCACCTCCAGGTCCCAGG + Intronic
907400238 1:54220744-54220766 CTGCTCCTTCACCAGCTCACTGG - Intronic
907736203 1:57115078-57115100 CAGCTCCACCTCCATCTCACCGG + Intronic
908941528 1:69440866-69440888 GTGCTCCACCACCAAGGCACTGG - Intergenic
910590431 1:88924132-88924154 TGGCTCCAACACCAGGTCACAGG - Intergenic
911634785 1:100222802-100222824 ATGCTCCACCACCAGATAAGTGG - Intronic
912738695 1:112173841-112173863 GGGCTCCTCCAACTGCTCACTGG - Intergenic
913501457 1:119476153-119476175 GTGCTCAGCCACCAGCTTAAGGG + Intergenic
915973916 1:160372602-160372624 GTGCTCCTCCCCCAGCTCCAGGG + Exonic
916176241 1:162041597-162041619 GTGCTCAACAATCAGCTCTCTGG - Intergenic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1063417595 10:5887235-5887257 GTGCTACAGAACCAGCTCATGGG + Intronic
1069079282 10:64070477-64070499 GGGCTCACCCACCAGCTCACAGG - Intergenic
1070536694 10:77384007-77384029 GTGCGTCACCATCAGCTCTCTGG + Intronic
1071072026 10:81705343-81705365 GGGCTGCACCATCAGCTCCCTGG + Intergenic
1072435457 10:95410597-95410619 GTGCCCCACTCCCAGCCCACTGG - Intronic
1076061436 10:127417078-127417100 CTGCCCCACCCCCAGCTCCCAGG + Intronic
1076250074 10:128978429-128978451 GTGCGCCCCGGCCAGCTCACCGG + Intergenic
1076261221 10:129068633-129068655 GTTCCCTGCCACCAGCTCACTGG + Intergenic
1077058799 11:608822-608844 GTGCTCCCCCACCAGCAGCCTGG + Exonic
1078823917 11:14907957-14907979 CTGCTCCTGCTCCAGCTCACTGG - Intronic
1078830037 11:14969952-14969974 TTGCTCCTGCTCCAGCTCACTGG + Exonic
1085407339 11:76271144-76271166 CTGCTCCACCACCTCTTCACAGG + Intergenic
1085763047 11:79258784-79258806 GTGCTCCCCCACCGGCTCCCTGG + Intronic
1085778038 11:79383558-79383580 CTGCTCAATCACCACCTCACTGG + Intronic
1090357675 11:126150737-126150759 GAGCTCCCCCACCCTCTCACTGG - Intergenic
1090798658 11:130156813-130156835 CTTCTCCACCACCCCCTCACTGG - Intergenic
1091019704 11:132088104-132088126 GTGTTCCACCACCATCCCAATGG - Intronic
1091875725 12:3931492-3931514 GGGCTCCACCTGCAGCTCTCAGG + Intergenic
1092265634 12:6978321-6978343 GCTCCCCACCAGCAGCTCACCGG + Exonic
1095100359 12:38175565-38175587 GTGTTCCACTAACATCTCACTGG - Intergenic
1096928263 12:55173418-55173440 GTGTTCCACCACCACCCCAATGG + Intergenic
1098036016 12:66302656-66302678 GTCCTCCTCCACCAGATCCCTGG - Exonic
1099470489 12:83042138-83042160 GTGCTCCCACACCATCTCAATGG - Intronic
1100271396 12:93028879-93028901 GTTCTTCACCAACACCTCACAGG + Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1103593654 12:122010004-122010026 CTGCACCACCCCCAGCCCACCGG + Intergenic
1104835051 12:131784293-131784315 GGGCTCTACCAGCAGCTCCCGGG - Intronic
1104929096 12:132328965-132328987 GTGGTCTACAACCAGCTCAACGG - Intronic
1104940001 12:132390593-132390615 GTGCCGCAGCCCCAGCTCACAGG + Intergenic
1112610205 13:100948060-100948082 GTGCTCTCCCACCTGCTCATGGG + Intergenic
1112901490 13:104363034-104363056 GTGCTCCACCACCACATCATGGG + Intergenic
1113681823 13:112249870-112249892 TTCCTGTACCACCAGCTCACAGG - Intergenic
1113995124 14:16058082-16058104 GTGCTCCCCCACCCTCTCCCCGG - Intergenic
1116898667 14:50341159-50341181 GTCCCCCACCAGCAGCTCAGGGG + Exonic
1118849399 14:69572761-69572783 GTCCTCCACCACCAACGCTCCGG - Exonic
1119382691 14:74239285-74239307 GTGCTCCACCCCCAGCACCCTGG + Intergenic
1122150888 14:99725591-99725613 TTCCTCCACAACCACCTCACAGG - Intronic
1122788305 14:104173976-104173998 TTGCTCCTCCACCACCTGACAGG + Intronic
1122823890 14:104360352-104360374 GGCCCCAACCACCAGCTCACAGG - Intergenic
1128043673 15:64597779-64597801 CTGCCCCATCCCCAGCTCACAGG + Intronic
1128333442 15:66771118-66771140 GCCCTCCACCTGCAGCTCACCGG - Intronic
1128997332 15:72306636-72306658 GTGCTCCACCACCAGCGGGTGGG - Intronic
1130577079 15:85102477-85102499 GTCCTACACCACAAGTTCACAGG + Intronic
1132085862 15:98907828-98907850 TTGGTCCTCCACCACCTCACTGG + Intronic
1132230978 15:100184077-100184099 GTGCTCCACAACCAGGACACTGG - Intronic
1132329863 15:101004756-101004778 GGGCTCCAGCCCCAGCTCAGGGG + Intronic
1132621158 16:868846-868868 CTGCACCCCCACCTGCTCACGGG - Intronic
1132870597 16:2114134-2114156 AGGCTCCACCACCAGCCCCCAGG - Intronic
1134244940 16:12532954-12532976 GTGCTGCGCCACCCGCTCCCTGG - Intronic
1134521935 16:14922770-14922792 AGGCTCCACCACCAGCCCCCAGG + Intronic
1134709604 16:16321421-16321443 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134716818 16:16361450-16361472 AGGCTCCACCACCAGCCCCCAGG + Intergenic
1134949998 16:18347224-18347246 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1134957934 16:18390709-18390731 AGGCTCCACCACCAGCCCCCAGG - Intergenic
1138512834 16:57518550-57518572 CTGCTCCATCAGCAGGTCACTGG - Intronic
1138552705 16:57756166-57756188 ATGCTTCACAGCCAGCTCACAGG - Intronic
1140869851 16:79096398-79096420 GTGCTCTTCCCCCTGCTCACTGG + Intronic
1141699751 16:85636919-85636941 GTGCTACCCCCCCAGCTCCCTGG + Intronic
1142431845 16:90032893-90032915 GTTCTTCACCACCACCTCACTGG - Exonic
1143139471 17:4733162-4733184 GTTCTCCAGCATCTGCTCACAGG - Exonic
1146206922 17:30912793-30912815 GTGCTCCACCCCCAACTCTCAGG + Intronic
1146208886 17:30926594-30926616 GTGCTCACACATCAGCTCACTGG - Intronic
1149239829 17:54635930-54635952 CAGCACCACCACCAGCTCATGGG - Intergenic
1152554760 17:81047259-81047281 GGGCTCCACCAAGAGCTGACAGG + Intronic
1156785353 18:40906241-40906263 GTGTGCCACAACTAGCTCACAGG - Intergenic
1158399647 18:57110517-57110539 GTGCTGCATCAACAGCACACTGG + Intergenic
1158869128 18:61667174-61667196 CTGATCCATCACCAGCTTACAGG - Intergenic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1161655347 19:5510996-5511018 GGGCTCCACCTCCACCTCTCAGG - Intergenic
1163279495 19:16306918-16306940 GGGCCCCACCCCCAGCCCACTGG - Intergenic
1166427416 19:42691977-42691999 GTCCTCCAGCTCCAGCTGACAGG - Intronic
1166788931 19:45386064-45386086 CTGCACCACCTCCAGCTCCCCGG + Exonic
1167309518 19:48728988-48729010 GTGGCCCAGCTCCAGCTCACGGG + Exonic
1167702662 19:51059825-51059847 GGGCACCACCACCAGCCCCCAGG - Exonic
926687110 2:15706605-15706627 CTGCCCCACAACCAGCTCTCAGG - Intronic
927042824 2:19246629-19246651 GTCCTCCATCACCAGCACCCGGG - Intergenic
929686322 2:44038385-44038407 GTGATCTAACACCAGCTGACAGG - Intergenic
930259205 2:49125412-49125434 GTGTTCAACCTGCAGCTCACAGG - Intronic
936053767 2:109245118-109245140 GAGCCCCTCCACCATCTCACGGG + Intronic
937740013 2:125339963-125339985 GTGCTCCAACACCAGGCCGCTGG - Intergenic
938536351 2:132252673-132252695 GTGCTCCCCCACCCTCTCCCCGG + Intronic
939643845 2:144672196-144672218 TTGCTCCTCCATCTGCTCACAGG + Intergenic
948712127 2:239831661-239831683 GTGCACCACCCCCAGCCCAGAGG - Intergenic
1169046465 20:2537709-2537731 GTGCTCCATCACCTTCCCACTGG + Intronic
1169978162 20:11353656-11353678 GGGCTCCAGCTCCAGCTCCCAGG - Intergenic
1171810169 20:29741027-29741049 GCGCTCCCCCACCATCTCCCCGG + Intergenic
1171865241 20:30484443-30484465 GTGCTCCGCCACCCTCTCCCCGG + Intergenic
1172875209 20:38160034-38160056 GGGCTCCCCCACAAGCACACTGG - Intronic
1172996097 20:39071554-39071576 GAGCTCCAGTACCAGCTCTCTGG - Intergenic
1173703748 20:45095204-45095226 GTGCCCCACCACCAGCAGGCTGG + Exonic
1177895365 21:26851099-26851121 GCTCTCCACCACTAGCTCCCAGG - Intergenic
1179190000 21:39115563-39115585 GTGACCCACAACCAGCTCCCAGG + Intergenic
1179331446 21:40406184-40406206 GTTCTCCACCAACAGTTCATAGG - Intronic
1179990991 21:44948182-44948204 ATGCTCCACGACCACCTCCCCGG - Intronic
1179991007 21:44948244-44948266 ATGCTTCACGACCAGCTCCCCGG - Intronic
1179991016 21:44948275-44948297 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991025 21:44948306-44948328 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991033 21:44948336-44948358 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991049 21:44948397-44948419 GTGCTCCACGACCAGCTCCCCGG - Intronic
1180064659 21:45406147-45406169 GTTCCCCACCACCTGCTAACCGG + Intronic
1180311968 22:11249327-11249349 GTGCTCCCCCACCCTCTCCCCGG + Intergenic
1184024835 22:41847635-41847657 CAGCTCCACCACCTGCTGACTGG + Intronic
1184755900 22:46515568-46515590 GTCCTCCACCTCCAGCCCCCGGG - Intronic
949883355 3:8677827-8677849 CCACTCCACCACCAGCTCTCAGG + Intronic
950127028 3:10516098-10516120 GTGTTTCACAACCAGCTCTCAGG - Intronic
954928080 3:54254916-54254938 GTCCTCCAGCCCCAGCTCAAAGG + Intronic
956641700 3:71421872-71421894 GTGCTCCATCAGCAGTTCAGAGG - Intronic
956872102 3:73428208-73428230 GTGCTCACCCACTTGCTCACTGG - Intronic
956915589 3:73867742-73867764 GTGCTCCAGAACTAGGTCACAGG - Intergenic
959155756 3:102664348-102664370 CGGCTCCTCCACCTGCTCACCGG + Intergenic
966086180 3:176068995-176069017 TCGCTCCACCACCAGGTCTCTGG - Intergenic
966631578 3:182081737-182081759 CTGCTCCATCTCCAGCTCACTGG - Intergenic
968000270 3:195200822-195200844 GTGGTCCAACAGGAGCTCACGGG + Intronic
970561666 4:17287653-17287675 CACCTCCACCTCCAGCTCACTGG + Intergenic
971715579 4:30171583-30171605 GTGCTCCTCCACTACCCCACAGG + Intergenic
973550601 4:52031954-52031976 ATTCTCCACCTCCAGCTCCCTGG - Intronic
977470933 4:97441432-97441454 GTCCTCCATCAGCTGCTCACAGG - Intronic
979439492 4:120734373-120734395 GTGTTCCACTAACATCTCACTGG - Intronic
980831138 4:138130539-138130561 GAGCTCTACCACCATTTCACAGG - Intergenic
983732368 4:171011728-171011750 TTGCTCCAGCTCCAGCTCAAAGG + Intergenic
986020761 5:3799739-3799761 GGGCTGCACCACCGGGTCACAGG - Intergenic
997241714 5:132312593-132312615 CTGCTCCACCACCACCTCAGGGG + Intronic
999428699 5:151508017-151508039 GTGCTTCACCAGGAGGTCACAGG + Intronic
1001050285 5:168408563-168408585 GTGGTCCAGCAGCAGCTCTCTGG + Exonic
1005098920 6:22148103-22148125 GTTCTCCAACCCCAGCTCAGTGG + Intergenic
1006406914 6:33850837-33850859 CTGCTCCACCAGCACCTCCCAGG + Intergenic
1008103690 6:47420432-47420454 CTTCCCCACCACCAGCTCAATGG + Intergenic
1010547182 6:77173006-77173028 GTGCTCCAGCACCAACCCTCTGG + Intergenic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1017710169 6:157160469-157160491 GTGCTCCACCACCTGTTCCAGGG + Intronic
1019488872 7:1301833-1301855 GGGCTCTGCCACCGGCTCACTGG + Intergenic
1020775634 7:12450794-12450816 TGGCTCCAGCATCAGCTCACAGG + Intergenic
1023917513 7:44601182-44601204 GTTCTCCAACACCTGCCCACTGG - Intergenic
1025263788 7:57439634-57439656 GTGCCCCACCCCCACCCCACAGG - Intergenic
1025635446 7:63316476-63316498 GTGCTCCACCCCCACCCCACAGG + Intergenic
1025647249 7:63431694-63431716 GTGCTCCACCCCCACCCCACAGG - Intergenic
1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG + Intronic
1039642131 8:39235035-39235057 GTCCTCCATCCCCAGGTCACAGG - Intronic
1039844573 8:41316750-41316772 GGGCTCCACCCACAGCCCACAGG + Intergenic
1040495317 8:47960683-47960705 GTCCTACAGCACCAGCTCTCGGG - Intronic
1041612169 8:59863735-59863757 ATGCTCTACCCCAAGCTCACTGG + Intergenic
1041666280 8:60448086-60448108 GTGCTACACCACCAGGGCCCTGG + Intergenic
1042847916 8:73186758-73186780 GTGCTCCATCACCAGGGCAGAGG + Intergenic
1045798939 8:106079257-106079279 GTCCTTCACCACCATCTCTCTGG - Intergenic
1046776279 8:118167292-118167314 CTGCTCCACCACATGCTCCCTGG + Intergenic
1048187019 8:132250728-132250750 GGGCTCCTCCCCCAGCTCACTGG + Intronic
1049430391 8:142560344-142560366 ATGGTCCATCACCAGCTAACAGG + Intergenic
1049430435 8:142560603-142560625 ATGGTCCATCACCAGCTAACAGG + Intergenic
1050234735 9:3565946-3565968 GGGCTCAAGGACCAGCTCACTGG + Intergenic
1056758360 9:89396934-89396956 ATTCACCAACACCAGCTCACAGG + Intronic
1059308748 9:113374229-113374251 GGGCTCCACCTCCAGCCCATGGG + Exonic
1059430134 9:114245029-114245051 GAGCTCTGCCACCAGCTCACGGG - Intronic
1059792979 9:117660769-117660791 GTTCTCCTACACCAACTCACAGG - Intergenic
1060126453 9:121052379-121052401 GTGCTCAACCTCCACCTCCCAGG - Intergenic
1061134843 9:128727859-128727881 GTGCTCCTCCTCTAGCTCGCTGG - Intergenic
1061211463 9:129195845-129195867 CTGCTTCACCTCCAGCTCTCAGG + Intergenic
1191668814 X:63730361-63730383 CTGCTCCACCACCTACTAACTGG - Intronic