ID: 1015927288

View in Genome Browser
Species Human (GRCh38)
Location 6:138323047-138323069
Sequence TTTTGCTTGTAGAGGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015927282_1015927288 24 Left 1015927282 6:138323000-138323022 CCAAGCAGAAGAACAAAATAGCA 0: 1
1: 0
2: 3
3: 44
4: 410
Right 1015927288 6:138323047-138323069 TTTTGCTTGTAGAGGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015927288 Original CRISPR TTTTGCTTGTAGAGGAGTGA TGG Intronic
No off target data available for this crispr