ID: 1015928742

View in Genome Browser
Species Human (GRCh38)
Location 6:138335309-138335331
Sequence CTCTGACTTTGGAGGGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015928742_1015928747 0 Left 1015928742 6:138335309-138335331 CCGATTTCCCTCCAAAGTCAGAG 0: 1
1: 0
2: 1
3: 25
4: 229
Right 1015928747 6:138335332-138335354 GACTGCCTGAACCTAAGTGCAGG 0: 1
1: 0
2: 2
3: 9
4: 153
1015928742_1015928749 10 Left 1015928742 6:138335309-138335331 CCGATTTCCCTCCAAAGTCAGAG 0: 1
1: 0
2: 1
3: 25
4: 229
Right 1015928749 6:138335342-138335364 ACCTAAGTGCAGGATCTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015928742 Original CRISPR CTCTGACTTTGGAGGGAAAT CGG (reversed) Intronic
900549128 1:3245256-3245278 CTTTGACTTTGGGGGAAAAATGG - Intronic
901188098 1:7387995-7388017 CTCTGACTTGGCAGGGGAAGGGG - Intronic
902228309 1:15011131-15011153 CTCAGTCTTTGGAGGCAGATCGG + Intronic
903544722 1:24116795-24116817 CTCAGACTTGGGAGGGACAGAGG + Intergenic
907480553 1:54743007-54743029 CACTGTCTTTGAAAGGAAATTGG + Intergenic
908040608 1:60108420-60108442 TTATGACTTTGGAGGGAATGTGG + Intergenic
908104278 1:60825356-60825378 CTCTGAATGTGAAGGGAAACTGG - Intergenic
908473152 1:64464130-64464152 CTCCCAGTTTGAAGGGAAATGGG + Intergenic
910464119 1:87478270-87478292 CTCTGCCTTTGGAAGGAAGGAGG - Intergenic
910616170 1:89200726-89200748 CACTGATTTTGGAAGGAAACTGG + Intergenic
915532692 1:156512289-156512311 ATCTGTCTTAGGAGAGAAATGGG - Intergenic
916061613 1:161102636-161102658 CTCATAGTTTGGTGGGAAATAGG + Intronic
916119490 1:161514989-161515011 CTGTGACTTTCTAGAGAAATAGG + Intronic
916129254 1:161596646-161596668 CTGTGACTTTCTAGAGAAATAGG + Intronic
917454879 1:175177718-175177740 CTGCCCCTTTGGAGGGAAATTGG + Intronic
917582294 1:176391450-176391472 CTCTGACTTTGAGGGGCAGTAGG + Intergenic
920577196 1:207070263-207070285 GTATGACTGTGGAGGGAAATGGG - Exonic
920693521 1:208164535-208164557 CACAGAATTTGGAGGGAAAAGGG + Intronic
921412217 1:214847910-214847932 GTCTGACTCTGGAGGGAGAAAGG + Intergenic
922414083 1:225404233-225404255 CTCTGGCTTCTGAGGGGAATTGG - Intronic
922810092 1:228410483-228410505 CTCTGGACTTGGAAGGAAATGGG + Intronic
922974306 1:229770961-229770983 CTTAGACTTTGGAGGGGAAAAGG + Intergenic
924170986 1:241340797-241340819 GGCTGAATTTGGAGGAAAATAGG + Intronic
924496001 1:244589735-244589757 ATCTCACTTTAGAAGGAAATCGG - Intronic
1063195419 10:3736776-3736798 ATGTGAATTTGGAGGGGAATGGG + Intergenic
1063729884 10:8684612-8684634 CTCTGACTTGGGATGGAAGGTGG - Intergenic
1064478565 10:15718417-15718439 CTTTGACTGTGGAGAGAATTTGG - Intronic
1065983540 10:30927380-30927402 ATATGACCTTGGAGGAAAATGGG + Intronic
1066523853 10:36253943-36253965 CTCTGACCTTGGAGCAGAATGGG + Intergenic
1068060684 10:52064335-52064357 TTCTGATTTTGGAGGAAAGTTGG - Intronic
1068726412 10:60308272-60308294 CCTTGACTTTGGAGGGAATCTGG + Intronic
1069316583 10:67111723-67111745 CCATGACTCTGGAGAGAAATGGG - Intronic
1069515176 10:69071744-69071766 CTCTGGCTTTGGAGAAGAATGGG - Intergenic
1071223389 10:83496400-83496422 GGCTGATTTTGGAGGGAAATTGG + Intergenic
1071918064 10:90318573-90318595 GTGTGACCTTGGAGGTAAATGGG + Intergenic
1072438366 10:95433634-95433656 CTCTGCCCTCGGAGGGGAATGGG - Intronic
1074762296 10:116676138-116676160 CTCTGACTTTTGAGGCCAAACGG + Intronic
1075397456 10:122137923-122137945 CTCTGACTTTGGACAGAAGGAGG + Intronic
1076550942 10:131277889-131277911 CACCGACTTGGGAGGGAAAAAGG + Intronic
1078733727 11:14000652-14000674 AGCTGACTTTGGGGGGAAAATGG - Intronic
1080304597 11:30822572-30822594 CACTGAGTTTGGGGGGTAATTGG + Intergenic
1080826870 11:35856060-35856082 GCCTGAATTTGGAGGGAAACAGG + Intergenic
1081053654 11:38380207-38380229 CTAAGACTTTGAAGGAAAATTGG + Intergenic
1081282483 11:41226803-41226825 GTTTGATTGTGGAGGGAAATAGG - Intronic
1082780734 11:57285653-57285675 CTTTTGCTTTAGAGGGAAATGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087153812 11:94882013-94882035 CTCGGCATTTGGAGGGAAATTGG + Intergenic
1088660146 11:112037210-112037232 CTGTGAGTTTGGAGGGATAGTGG + Intronic
1088964485 11:114704237-114704259 ATCTGACTTGGGATGAAAATTGG - Intronic
1089981509 11:122776655-122776677 CCTTGTCTTTGGAGGGACATGGG + Intronic
1090917683 11:131180258-131180280 CTCTAACTTTGAAGAGAACTTGG + Intergenic
1094231458 12:28108874-28108896 CTCTGATTTTTGAGGGCAACTGG - Intergenic
1095431013 12:42134605-42134627 GTCTGAGTAGGGAGGGAAATGGG - Intronic
1096505265 12:52088566-52088588 CACTGGCTGTGGAGGGGAATCGG - Intergenic
1098526411 12:71492025-71492047 CTCTAACTTTAGGGGTAAATGGG + Intronic
1099149363 12:79089880-79089902 CTCTGAGTTTTGAGTGAATTAGG - Intronic
1101700697 12:107170915-107170937 TGGTGAGTTTGGAGGGAAATGGG - Intergenic
1101799608 12:108009308-108009330 TTCTGAATATGGAGGAAAATTGG - Intergenic
1105939170 13:25131874-25131896 CTTGGACTTTGGGGGGAAAATGG - Intergenic
1106496211 13:30278838-30278860 CACTGCCTTTTGAGGGATATGGG + Intronic
1110028931 13:70580494-70580516 ATCTCACTTATGAGGGAAATTGG + Intergenic
1111836838 13:93398720-93398742 CTCTGCCTCTCGAGGGTAATGGG - Intronic
1113249248 13:108433082-108433104 CTGGCAATTTGGAGGGAAATTGG - Intergenic
1113486593 13:110657360-110657382 CCCTGCCTTTGAGGGGAAATGGG - Intronic
1114203572 14:20546666-20546688 CTCTGGTTTTGGCTGGAAATGGG - Intergenic
1114277678 14:21162279-21162301 CTCTGACTTGAGAAGGAACTGGG + Intergenic
1115197895 14:30821575-30821597 CTCTTACTTTGCAGGGATAGTGG - Intergenic
1117108287 14:52421188-52421210 CTCTGACACAGGAGGGAAAATGG - Intergenic
1117183401 14:53215621-53215643 CTCTAGCTTTGGAGGAAAGTGGG - Intergenic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1120217811 14:81699319-81699341 CTATGACTTTGGAGGGAACAGGG - Intergenic
1121844905 14:97164227-97164249 CTCTGACATCAGAGAGAAATGGG - Intergenic
1122898161 14:104770692-104770714 CTCTGAGTGTGGAGAGAAAAGGG + Intronic
1123184738 14:106505972-106505994 CTCCCACTTTGGAAGGAAGTTGG + Intergenic
1123539337 15:21272427-21272449 CCCTGACTATGGAGTGAAAAAGG - Intergenic
1127793066 15:62415531-62415553 CTTTGACTTTGAGGGGAAAGAGG + Intronic
1128239827 15:66094343-66094365 CTCTGACTTGGTAGGGGAGTGGG - Intronic
1131340137 15:91591218-91591240 CTCTAACTGAGGAGTGAAATAGG + Intergenic
1132021072 15:98363324-98363346 CTATGACTATGGAGGGGACTTGG - Intergenic
1132271945 15:100533917-100533939 CTCTGAGTTTGCTGGGAAATAGG + Intronic
1135159176 16:20078377-20078399 CTCAGAGTTTGGAAGGCAATAGG + Intergenic
1135810209 16:25579926-25579948 CTCCTTCTTTTGAGGGAAATGGG + Intergenic
1138059318 16:53873130-53873152 CTTTGATTATGGAGGGAAAGAGG + Intronic
1139085711 16:63583190-63583212 CTCTGAATTTGAAAGAAAATGGG - Intergenic
1139278798 16:65751916-65751938 CTATGACTATGGAGGGAGATGGG - Intergenic
1141848285 16:86626295-86626317 CACTGACTTTGGAGGGAACTTGG - Intergenic
1145886816 17:28387816-28387838 GTCTGGCTTTGGTGGGAAATAGG + Intronic
1148557966 17:48589887-48589909 GTCTGACTTTGTGGGGAAAAGGG - Intronic
1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG + Intergenic
1149440590 17:56670489-56670511 CTCAGCCTTTGGAGGGGAAATGG + Intergenic
1150106333 17:62465083-62465105 CTCTGAGTTAGGGAGGAAATGGG + Intronic
1152033677 17:77858742-77858764 CTGTGACTTTGGAGAGCCATGGG + Intergenic
1153734273 18:8048138-8048160 GTCTGACATTGGTGGGAAAATGG + Intronic
1153835060 18:8956194-8956216 CTCTGACCTTGTAGTCAAATGGG + Intergenic
1154066565 18:11111976-11111998 TTCTGACTTAAGAGGGAAAATGG + Intronic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155820657 18:30371020-30371042 CACTTACTTTGGAGAGGAATCGG - Intergenic
1155860839 18:30897359-30897381 CTCTGAGTTTGGTGGAAAAAAGG + Intergenic
1157070844 18:44405875-44405897 CTTTTTCTTTGGAGTGAAATAGG + Intergenic
1157505056 18:48220165-48220187 CTCTGCCTTCAGAGGGAACTGGG - Intronic
1157868018 18:51203145-51203167 CCCTGACTTTGTAGCCAAATTGG + Intronic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158402550 18:57133915-57133937 ATCAGAGTTGGGAGGGAAATGGG + Intergenic
1159002042 18:62982863-62982885 CTTAGACTTTGGGTGGAAATGGG + Intergenic
1159774349 18:72585927-72585949 CTCTGATTTTGGAGTAAAGTTGG - Intronic
1165026995 19:32969498-32969520 CTCTGATCTTGGAGGGGAGTCGG - Intronic
1167137145 19:47623630-47623652 ATCTGGCTTTGCAGGGGAATGGG - Intronic
1168205647 19:54848716-54848738 CTGTATCTTTGGATGGAAATTGG - Intronic
925806212 2:7651554-7651576 TTTTGACTTTTGAGGAAAATGGG - Intergenic
925984347 2:9203836-9203858 CTCTCACTTTGGGGATAAATGGG + Intergenic
926829771 2:16948863-16948885 CTCTGACTTTGGAGAGCATAAGG + Intergenic
927624526 2:24700596-24700618 CATTGAGATTGGAGGGAAATGGG + Intronic
929829157 2:45333647-45333669 TTATGACTTTGAAGGGAAAAGGG + Intergenic
930535715 2:52643733-52643755 ATCAGACTTTGGAGGGAATTGGG - Intergenic
931635593 2:64338342-64338364 CTCTCAGTGTGGAGGGAACTGGG - Intergenic
931697020 2:64879014-64879036 CTCTGCCTCTGGTGGGAAATGGG - Intergenic
932133880 2:69211782-69211804 GTCTGACTGTGGAGGGCACTAGG - Intronic
932912067 2:75817045-75817067 ATCTGACTTTGGAGGAAAGGTGG - Intergenic
933017444 2:77146622-77146644 CTGTGACTTTTAATGGAAATAGG - Intronic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
940600081 2:155847771-155847793 CTCTGACATTGGAGGGCCCTTGG - Intergenic
940834653 2:158507554-158507576 CTCTGCTTTTGGAGGGAGAATGG + Intronic
941396550 2:164980993-164981015 CCCTGACTATGGAGTGAAAAAGG - Intergenic
942214675 2:173706993-173707015 CTCTTACTCTGGAAGGACATGGG + Intergenic
945956395 2:216090208-216090230 CTCTGAGTTTGAAGGCAAAGGGG + Intronic
946044644 2:216810848-216810870 CGCTGACTCTGGAAGGAACTAGG + Intergenic
946116614 2:217468323-217468345 CTCTGCCTTTGGAAGGTGATGGG - Intronic
946183038 2:217960383-217960405 CTCTGACAGTGGAGGGCAAGGGG + Intronic
947063415 2:226192235-226192257 CTTTGACTTTGGATGGATGTGGG + Intergenic
1169535326 20:6532744-6532766 CTGGGCATTTGGAGGGAAATGGG + Intergenic
1169646812 20:7820227-7820249 CTCTGAGTTTGGAGGTGTATTGG - Intergenic
1170073927 20:12398443-12398465 TCCTGACTTTGGAGGGACAGAGG + Intergenic
1170499091 20:16956289-16956311 CTGTGACTTTGCAGAGAAACAGG + Intergenic
1172356445 20:34283623-34283645 CTATGAGTTTGGTGAGAAATTGG - Intronic
1172869696 20:38128419-38128441 TTATGAGTTTGGAGGGAGATGGG - Exonic
1172884273 20:38220998-38221020 CTCTGCCTTCAGAGGGAAAATGG + Intronic
1173835546 20:46122941-46122963 ATCTGCCTTTGAAGGGCAATGGG + Intronic
1175461804 20:59157416-59157438 CTCTGGCTTGGGAGGCGAATTGG + Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1175857308 20:62129046-62129068 CTCTGAATCAGGAGGAAAATGGG - Intronic
1176080455 20:63270028-63270050 CTCTGGCTTGAAAGGGAAATTGG + Intronic
1177193358 21:17876315-17876337 CTCTGAATTTGGTGAGAACTTGG + Intergenic
1177714303 21:24819135-24819157 CTCTGACTTTGAAGACAGATGGG + Intergenic
1177824743 21:26069589-26069611 CTCACACTTAGGAGAGAAATAGG - Intronic
1179807957 21:43852031-43852053 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179808028 21:43852404-43852426 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181874956 22:25933171-25933193 CTCTGAAATTGGAAAGAAATAGG - Intronic
1183287475 22:36976556-36976578 CTCTGAATTCTCAGGGAAATGGG + Intergenic
1185175596 22:49324794-49324816 CTCAGTCTGTGCAGGGAAATGGG - Intergenic
951136305 3:19107635-19107657 CTCTGATCTTGGAGCAAAATTGG - Intergenic
951627734 3:24684658-24684680 ATCTGACTTTGACGGGAGATGGG + Intergenic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
953552597 3:43915282-43915304 CTCTGACTTTGGACAGAACTGGG - Intergenic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
954223111 3:49166406-49166428 CCCAGACTTTGTGGGGAAATGGG - Intergenic
955272596 3:57516509-57516531 GTCTGATTTTGCAGGGTAATTGG - Intronic
955612073 3:60768414-60768436 CTCTGAGTTGGCAGGGAAAGAGG - Intronic
956238039 3:67096950-67096972 CTATGACTTTGGAAGGAATAGGG + Intergenic
958614828 3:96479718-96479740 CTCTGACTTTTGCAGGCAATAGG - Intergenic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
960530681 3:118760828-118760850 CTCTAAATTTGGATGAAAATGGG + Intergenic
960617491 3:119609330-119609352 CACTTACTTTGGAGGGAAAAAGG - Intronic
960680792 3:120245415-120245437 CTTTGATTGTGGAGGAAAATTGG + Intronic
962253341 3:133853055-133853077 CTCCTACTTTGGAGGGATATGGG + Intronic
962738269 3:138344933-138344955 CTCTGACTTTAGCCAGAAATTGG + Intergenic
964753771 3:160076487-160076509 CCCTGCCTTTGGTAGGAAATTGG - Intergenic
965698851 3:171438920-171438942 TTCTGATTTTGGAGGGACATAGG - Intronic
966471014 3:180288924-180288946 CTATGACTTTGGAGGCATATGGG - Intergenic
969852930 4:9976379-9976401 CTCAGTCTTTGAAGGTAAATGGG + Intronic
969889051 4:10242801-10242823 CTTGGACTATGTAGGGAAATAGG - Intergenic
971954485 4:33398413-33398435 CACTAACATTGGATGGAAATGGG + Intergenic
972718647 4:41674351-41674373 CTTTGTCTTTTGAGGGAAAAGGG - Intronic
973801920 4:54486942-54486964 ATATGAATTTGGAGGGAAGTGGG - Intergenic
974501420 4:62709035-62709057 CTCTGAGTTTGGAGTGTAATTGG + Intergenic
975163265 4:71147907-71147929 CTGTGACTCTAGAGGGAACTGGG + Intergenic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
976918146 4:90404284-90404306 CTGTGACTTTTGTGGGGAATGGG - Intronic
977236691 4:94516315-94516337 CTCTAACTTTTGAGTAAAATTGG + Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978759365 4:112338930-112338952 CTCTGAGTTTGGTGTTAAATGGG - Intronic
979388410 4:120098129-120098151 CAGTCACTTTGGAGGGAAGTGGG + Intergenic
983754607 4:171319750-171319772 ATTTTACTTTGAAGGGAAATGGG - Intergenic
985938890 5:3118417-3118439 GTCTCTCTTTGCAGGGAAATTGG - Intergenic
988204074 5:28111572-28111594 CTCTGCAATTGGAGAGAAATGGG + Intergenic
988979715 5:36554591-36554613 CTTGGAGTTTGGAGGGAAATTGG - Intergenic
995401235 5:111744324-111744346 CACTAAATTTGGAGGGAAAGTGG + Intronic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001828460 5:174765405-174765427 CTCTATTTTTGGAAGGAAATTGG + Intergenic
1001883850 5:175270762-175270784 CTCTGACTGTGAAGGGATGTAGG + Intergenic
1003487300 6:6590677-6590699 CTGCCACTTTGGAGGGAGATGGG + Intronic
1004484300 6:16051510-16051532 CTCTCACTTTGAGGGGTAATGGG - Intergenic
1005947673 6:30606138-30606160 CTCTGACGTTTGAGGGGGATGGG + Exonic
1007294269 6:40809930-40809952 CTCTGACTTTGGAGTCATAGAGG + Intergenic
1007519754 6:42442412-42442434 CTCTGACTTTGGAGATAACAGGG - Intronic
1007664656 6:43507139-43507161 CTGGGACTTGGGAGGGAACTGGG - Exonic
1010374712 6:75153832-75153854 CTATGACTTGGGAAGGAAAATGG - Intronic
1012499961 6:99877557-99877579 ATCTTAGTTTGGAGGGAAAGAGG - Intergenic
1013097057 6:106954942-106954964 CACTGACTTTGGTTGTAAATGGG - Intergenic
1013422731 6:109980302-109980324 GTCTGACTTTGGAAAGAAAAAGG + Exonic
1014520768 6:122439396-122439418 CTGTGACTTTGCAGGGTAAAGGG - Intergenic
1014540346 6:122668366-122668388 CTCTTCCTTTGAAGAGAAATCGG - Intronic
1014769665 6:125446295-125446317 CGCTGACTTTGGTGGGAACCGGG + Intergenic
1015928742 6:138335309-138335331 CTCTGACTTTGGAGGGAAATCGG - Intronic
1016117100 6:140300835-140300857 ATCTGAAATTGGAGGCAAATTGG + Intergenic
1016234658 6:141848775-141848797 ACCTGACTTTGGAGGGATGTGGG - Intergenic
1016894150 6:149036173-149036195 CCCTGGCTGTGGAGGGAACTGGG + Intronic
1017000773 6:149995782-149995804 CTGTGACTGTGCAGGGACATAGG - Intergenic
1017398118 6:154027714-154027736 CTCTGCCTTTGGAAAGAAAAAGG - Intronic
1017864944 6:158435190-158435212 CCCTGACTGTGGGGGGAAATGGG - Intronic
1018589810 6:165407083-165407105 CGAGGACTTAGGAGGGAAATTGG - Intronic
1018665419 6:166132443-166132465 TTCTGGCTATGGAGGGAGATGGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1021586001 7:22209076-22209098 TACTGACTTGGGATGGAAATGGG + Intronic
1023758119 7:43439369-43439391 CTCGGACTTTGGAGAGACACAGG - Intronic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026662172 7:72311860-72311882 CTCAGACTTTGAAGAAAAATAGG + Intronic
1028675528 7:93456356-93456378 GTCTAACTTCAGAGGGAAATGGG + Intronic
1028881369 7:95884101-95884123 GACTGACTGTGGAGGAAAATGGG - Intronic
1030099712 7:105934681-105934703 CTCTTACCTGGGAGGGAGATGGG + Intronic
1032035396 7:128517671-128517693 CTCTGAGTTAGGGAGGAAATGGG + Intergenic
1032582121 7:133113088-133113110 CTCTGACTGTGGACTGAAAGCGG - Intergenic
1035895305 8:3393132-3393154 CTCTGACTTAAGGGAGAAATAGG - Intronic
1037292761 8:17368610-17368632 CTTTGACTCTGGAGGGAGATGGG - Intronic
1037308922 8:17534825-17534847 TTTTAACTTTGGAGTGAAATAGG + Intronic
1037427281 8:18770111-18770133 CTGTGAGGTTGGAGGGAAACTGG - Intronic
1037886187 8:22597672-22597694 CTCTTACTTTGGAGGGAGTCTGG + Intronic
1038585759 8:28787697-28787719 GTCTGACTTGGGAGGCAAAGGGG + Intronic
1038689160 8:29745753-29745775 CTCTGACCTTGGAGGATAAATGG - Intergenic
1042718396 8:71801247-71801269 ATCTGACTTTGGGGGGGATTGGG - Intergenic
1045652617 8:104355225-104355247 TGTTGAGTTTGGAGGGAAATGGG + Intronic
1046353241 8:113044190-113044212 CTCTGACTTTGGAGGATAGTTGG + Intronic
1047412053 8:124631808-124631830 CTCTGCCTTTGGAGGGCCGTGGG - Intronic
1048421782 8:134284415-134284437 CTCTGACCTTGGAGCAAAGTGGG - Intergenic
1049453363 8:142674817-142674839 CTCTGACTGTGGGTGGAGATGGG - Intronic
1056165974 9:83941307-83941329 CTTTGACTTTGTTTGGAAATAGG + Intronic
1056314888 9:85378567-85378589 CTCTGACTTAGTAGGCAAATGGG + Intergenic
1057184110 9:93046846-93046868 CTCAGACTTTGGAGGATATTGGG + Intergenic
1057189832 9:93080660-93080682 CTCTGACAGTGGAGGGACCTGGG - Intronic
1058151243 9:101465740-101465762 CTCTGCCCTGGGAGAGAAATGGG + Intergenic
1058428337 9:104895785-104895807 CTCAGGCTAGGGAGGGAAATGGG - Intronic
1186342438 X:8658739-8658761 CTCTCACTTTGCAGGTAAAGAGG + Intronic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1187733446 X:22280015-22280037 CTCTAACTACGGGGGGAAATGGG - Intergenic
1189097476 X:38155768-38155790 CTCTGTCTTTTGTGGGAAACTGG - Intronic
1189292213 X:39894563-39894585 ATCTTACTTTGTAGGGAAATTGG - Intergenic
1192129782 X:68538670-68538692 GTCTTACTGTGGTGGGAAATAGG + Intergenic
1192425232 X:71068941-71068963 CTCTTACTTTTCAGGAAAATTGG + Intronic
1194338968 X:92685886-92685908 TTCTGACTTTTGAGAAAAATTGG + Intergenic
1195235550 X:102894005-102894027 CTCTTACTCTGTGGGGAAATAGG - Intergenic
1197886455 X:131223045-131223067 CTCTGACTTTGGAGGTACCAAGG - Intergenic
1200647361 Y:5802669-5802691 TTCTGACTTTTGAGAAAAATTGG + Intergenic
1201614629 Y:15883535-15883557 GGCTGATTTTGGAGGGAAGTTGG + Intergenic
1201615739 Y:15896242-15896264 GGCTGATTTTGGAGGGAAGTTGG - Intergenic