ID: 1015932228

View in Genome Browser
Species Human (GRCh38)
Location 6:138373297-138373319
Sequence CATATTATAAGAAATGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015932228_1015932229 7 Left 1015932228 6:138373297-138373319 CCTGACACATTTCTTATAATATG No data
Right 1015932229 6:138373327-138373349 CATGTTTGCATCTTTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015932228 Original CRISPR CATATTATAAGAAATGTGTC AGG (reversed) Intergenic
No off target data available for this crispr