ID: 1015935539

View in Genome Browser
Species Human (GRCh38)
Location 6:138403855-138403877
Sequence TCCCACCACCTCCTCCGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015935534_1015935539 13 Left 1015935534 6:138403819-138403841 CCAGAACAGTTCCAGATTCTCTC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 247
1015935537_1015935539 -9 Left 1015935537 6:138403841-138403863 CCATGTGTCTGTGGTCCCACCAC 0: 1
1: 0
2: 2
3: 18
4: 268
Right 1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 247
1015935535_1015935539 2 Left 1015935535 6:138403830-138403852 CCAGATTCTCTCCATGTGTCTGT 0: 1
1: 0
2: 5
3: 26
4: 393
Right 1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015935539 Original CRISPR TCCCACCACCTCCTCCGCAA GGG Intronic
900622839 1:3595288-3595310 TCCCTCCACCTCCACCCCAGAGG - Intronic
901432140 1:9222979-9223001 TCCCATCACCTCCTCAACCAGGG + Intergenic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903967366 1:27099159-27099181 CCCCCCCACCGCCTCCACAATGG + Exonic
905483584 1:38279529-38279551 TACAACCACCACCTCCTCAATGG + Intergenic
907034901 1:51207459-51207481 TCCCACCTCGGCCTCCGAAAGGG - Intergenic
907409305 1:54273551-54273573 TGCCAACACCTCCCCTGCAAAGG - Intronic
911264812 1:95730762-95730784 TCTGTCCACCTCCTCCTCAAAGG - Intergenic
911467785 1:98276660-98276682 TCCCACCACCTCCATCATAATGG + Intergenic
914914613 1:151811430-151811452 TCCCACCCCCTCCTCCAGATCGG - Exonic
916128671 1:161592883-161592905 ACACACCACCTCCTCCAGAATGG - Intronic
916138589 1:161674714-161674736 ACACACCACCTCCTCCAGAATGG - Intronic
917887143 1:179398018-179398040 TCGCACCACCTCTCCAGCAAGGG - Intronic
918018870 1:180665096-180665118 TCCTAAGACCTCCTCAGCAATGG - Intronic
918182022 1:182092239-182092261 TCCCAACACCACCTCCACATTGG + Intergenic
918463018 1:184795403-184795425 TCCCCCCAACTCCTCCCCATGGG + Exonic
918718758 1:187825653-187825675 TCACACCAGATCCTCAGCAATGG - Intergenic
919430811 1:197488660-197488682 TCACACTAGCTCCTCAGCAATGG + Intergenic
920016258 1:202912002-202912024 TGCATCCACCTCCTCCACAATGG - Intronic
921032164 1:211343530-211343552 TCCCACCTCAGCCTCCGGAATGG + Intronic
921800581 1:219398582-219398604 CCACACCATCTCCTCAGCAAGGG - Intergenic
922746470 1:228047127-228047149 TCCCACCACCAGCTCAGGAAGGG - Intronic
924772295 1:247088546-247088568 TCCCACTGCCTCCTCCCCAGGGG - Intergenic
1064136898 10:12758766-12758788 TCCCACCACCTCCTGCCCTTAGG - Intronic
1064656797 10:17564433-17564455 TTCCAACACCCCCTCCGCAGTGG - Intergenic
1065323821 10:24533165-24533187 TGTCACCACCTCCTCCTCAAAGG + Exonic
1065574164 10:27101531-27101553 GCCAGCCACCTCCTCCACAAGGG - Intergenic
1067464744 10:46489406-46489428 TCGCACCATCTCCTCCCCAATGG + Intergenic
1067622450 10:47895247-47895269 TCGCACCATCTCCTCCCCAATGG - Intergenic
1068840994 10:61613966-61613988 TCCCAGCACCTCCTACTCACAGG - Intergenic
1069066166 10:63944021-63944043 TCCCACCATGTTCTCCCCAAAGG + Intergenic
1069871671 10:71536792-71536814 TTCCACCACCTCCTCCACTTGGG - Intronic
1070302191 10:75211332-75211354 GCCCAGCCCCTCCTCCGCAGAGG - Intronic
1070432688 10:76357143-76357165 TCGCACCCCCACCTCAGCAATGG - Intronic
1072613809 10:97036263-97036285 TACCACCACCTCCTCATCACAGG - Intronic
1074421133 10:113309667-113309689 TCCCCCCACCTCCTCCCACAGGG + Intergenic
1074843215 10:117375227-117375249 TCCCGCCACCGCCTCCGCCCGGG + Exonic
1075721727 10:124591368-124591390 CCCCACCACCTCCCCTGCCATGG + Intronic
1075764691 10:124884120-124884142 GCCCACCACCTGCTCACCAAAGG - Intergenic
1075903519 10:126062292-126062314 ACCCACCACCACCCCAGCAAAGG + Intronic
1077855188 11:6116691-6116713 TCACAACACCTCTTCAGCAAGGG + Intergenic
1078523831 11:12085668-12085690 TTCCTCCACCTCCTCCGCTCAGG + Intergenic
1078545050 11:12241137-12241159 GCCCATCACCTCCTCTGAAAAGG + Exonic
1079324565 11:19480487-19480509 TCCCACCACCGCCACCGCTCAGG - Intronic
1079816967 11:25073400-25073422 TCCCAGCACTTCCTCCACACAGG - Intronic
1079983046 11:27171916-27171938 GCCCACCACCACCTCCCCACTGG - Intergenic
1080448853 11:32362238-32362260 TCCCACCTCCTCCTGCTTAAAGG + Intergenic
1080638192 11:34141744-34141766 TGCCACCATCTGCTCCTCAATGG - Exonic
1082825116 11:57571849-57571871 TCCCTCCACCTCAACCACAAGGG - Intergenic
1083453344 11:62761512-62761534 GAACACCACCTCCTCCGCGAGGG - Intergenic
1083649936 11:64196855-64196877 TCTCACCACCCCCTCTGCTATGG + Intronic
1085052842 11:73388663-73388685 TCCCCCCGCCTCCTCCTCACAGG - Intronic
1085246902 11:75108991-75109013 TCCCAACATCTGCTCCACAAGGG - Intronic
1085389626 11:76175804-76175826 TCCCACCACCACCCCAGGAATGG - Intergenic
1085481088 11:76823605-76823627 TCCCACCTCCTTCTCCTGAAAGG - Intergenic
1089160412 11:116432742-116432764 TCCCACCAGCTCCTCGCCTAGGG + Intergenic
1090404651 11:126469438-126469460 GCCCACCCCCTCCTCCCCCAGGG - Intronic
1090756816 11:129798901-129798923 TCACACCAGCTCCCCAGCAATGG + Intergenic
1091368222 11:135039182-135039204 CCCCAGCTCCACCTCCGCAAAGG + Intergenic
1091586956 12:1822056-1822078 TCCCACCCCCACCTCCCCACCGG + Intronic
1095405603 12:41863807-41863829 TACCTCCCCCTCCTCCCCAAAGG + Intergenic
1096593721 12:52680216-52680238 TCCCACCACCTCCTCCACTGCGG + Exonic
1096687004 12:53294840-53294862 TCCCACCACCTCACTGGCAACGG + Intergenic
1096747897 12:53740133-53740155 TCCCTCCACCTCCACTGCAGGGG + Intergenic
1097026071 12:56056515-56056537 TCTAACCACCTCCTCTGCCATGG + Intergenic
1097030809 12:56087958-56087980 TACCCCTACCTCCTCCTCAAAGG - Intronic
1099478600 12:83139981-83140003 TCTCACCACCTCCTCGGCCTCGG + Intergenic
1102347491 12:112169209-112169231 GCCCACCAACTCCTCAGCCAGGG + Intronic
1102965442 12:117121676-117121698 TTCCCCCACCACCTCCGCAAAGG - Intergenic
1104901685 12:132192786-132192808 TCCCTCCTCCTCCTCCTCTAAGG + Intergenic
1105272949 13:18894829-18894851 TGCCTCCATTTCCTCCGCAAAGG + Intergenic
1106712134 13:32349144-32349166 TACCACAACCTCCACCTCAAAGG - Intronic
1107028860 13:35830794-35830816 TCCCTTCACCACCTCCACAAAGG + Intronic
1107459419 13:40587194-40587216 TTCCACCACCTTCTTCCCAAAGG + Intronic
1111814589 13:93134866-93134888 TCCAACCACCACATCCACAAAGG - Intergenic
1113223223 13:108129326-108129348 TCCATCCCCCTCCTCAGCAAAGG + Intergenic
1113330155 13:109319141-109319163 ACCCACCTCCCCCTCCCCAATGG - Intergenic
1118895613 14:69943071-69943093 CACCACCACCCCCTCCCCAAGGG - Intronic
1119688768 14:76654325-76654347 TCCCACCACCTCCTCCCCTTTGG + Intergenic
1120730087 14:87992501-87992523 ACCCACCAACTCCTCCAAAAGGG + Intronic
1121245724 14:92459702-92459724 TCCCACCGCCTGCTCCTCACAGG - Intronic
1122745289 14:103894149-103894171 TCCCCCCACCCCCTCCACACGGG - Intergenic
1124725019 15:32148844-32148866 TCCCACCATGCCCTCCGCCAGGG + Intronic
1127014586 15:54669184-54669206 TCACACCAGCTCATCAGCAATGG + Intergenic
1127953273 15:63831350-63831372 TCCCACCTCGGCCTCCCCAAGGG + Intronic
1128119383 15:65134392-65134414 TCCCACCTCAGCCTCCCCAATGG - Intergenic
1129428442 15:75481373-75481395 ACCCCCCACCTCCTCCGGATGGG - Intronic
1129981772 15:79878711-79878733 TCCCACCACTCCCTCCACATAGG - Intronic
1130656639 15:85795869-85795891 TCCCACCTCCACCTCCGTCAGGG - Intergenic
1131157449 15:90083937-90083959 TCCCACTACCTCCTCCCCTCAGG + Exonic
1132131567 15:99285370-99285392 TGCATCCACCTCCTCCGCAGTGG + Intronic
1132502686 16:291582-291604 TCCCACCACCTCATCCCCTCTGG + Intronic
1132692211 16:1186698-1186720 TGGCACCACCGCCTCCTCAACGG + Intronic
1132723567 16:1328624-1328646 TACCACCACGTCTTCCTCAAAGG - Intergenic
1132784291 16:1646268-1646290 TCCCACCTCCTCCTCCTCCTGGG - Intronic
1132833655 16:1942001-1942023 TCCCACCCCCTCCACTCCAAAGG - Intronic
1133998820 16:10766972-10766994 TCCCACCAACCCCTCCCCACAGG + Exonic
1134805475 16:17120432-17120454 TCCCAGCACCTCATCCGGAAGGG + Intronic
1135146778 16:19969507-19969529 TCCCTCCACCTCTTCCTCCACGG - Intergenic
1136791068 16:32968520-32968542 CCCCCCCACCTCCCCCACAAAGG + Intergenic
1137586714 16:49668211-49668233 TCCCACCTCCTACTCAGCATGGG - Intronic
1139242334 16:65405953-65405975 GCCCACCACCTCTTCAGCAAAGG - Intergenic
1139361196 16:66401223-66401245 TCCCACCCCCTCCTCCTCCCTGG - Intronic
1141685435 16:85567188-85567210 CCCCATCCCCTCCCCCGCAACGG - Intergenic
1142292320 16:89198826-89198848 TCCCTCCACCTCCTCCTGGAAGG + Intronic
1142304578 16:89278303-89278325 TCCCACCTCCTCCTACCCACTGG - Intronic
1142985379 17:3691925-3691947 TCCCACCAGCTCCTGGGCAGGGG + Intronic
1143107005 17:4535013-4535035 GCCCCCCACCTCTCCCGCAACGG + Intronic
1143772247 17:9176085-9176107 CCCCACCACCTCCCCTGCAAAGG + Intronic
1144562143 17:16329595-16329617 ACCCACCCCATCCTCGGCAAGGG + Intronic
1146069599 17:29668077-29668099 TCCCACCACCTACTCAAGAAAGG + Intronic
1147153340 17:38531096-38531118 CCCCCCCACCTCCCCCACAAAGG + Exonic
1147261679 17:39212655-39212677 TCCCTCCACCTCCTCTGTGATGG - Intronic
1147393245 17:40122566-40122588 CCCCACCCCCTCCTCCGCCTCGG + Intronic
1147424876 17:40341756-40341778 CCCCACCACCTCCTCCACCACGG + Intronic
1148382480 17:47209905-47209927 TCCCACTACCTCCTAGGAAAAGG - Intronic
1148450467 17:47774502-47774524 TACTTCCACCTCCTCTGCAAAGG + Intergenic
1149026214 17:52030383-52030405 TCCCACCTCCTCCTCTCCATGGG - Intronic
1150069222 17:62138056-62138078 ATCCATCACCTCCTCCGCAAAGG + Intergenic
1150489845 17:65566672-65566694 TCCCAGTCCCTCCTCTGCAAAGG - Intronic
1150610052 17:66726598-66726620 TCCCACCACTCCCTCCGCCTCGG - Intronic
1151355137 17:73553749-73553771 TGCCAGCACCTCCTCAGGAAGGG - Intronic
1152447265 17:80353079-80353101 TTCCACCACCTGCTCCCCCAGGG - Intronic
1154090117 18:11350121-11350143 TCACACCAGCTCCTCAGCAATGG + Intergenic
1158801013 18:60909179-60909201 TCCCTCCACCTCCTCCCGAAAGG - Intergenic
1159802331 18:72916937-72916959 TCACACCAGCTCCCCAGCAATGG - Intergenic
1160458251 18:79018380-79018402 TCCCACCACTTCATCAGCTAAGG + Intergenic
1160726833 19:621091-621113 ATCCATCACCTCCTCCGCAAAGG + Exonic
1161295633 19:3518934-3518956 TCCCACTACCTCCTCTGGTAGGG + Intronic
1161582227 19:5087185-5087207 TCCCACCCCCTCCTTGACAATGG - Intronic
1162108789 19:8388719-8388741 TCCCACCTCAGCCTCCTCAAAGG + Intronic
1162765659 19:12918009-12918031 TCCCACCTCAGCCTCCGAAATGG - Intronic
1163287295 19:16356809-16356831 TCCCACAAGCTCCTCCCCCAGGG + Intronic
1166735566 19:45082206-45082228 TGCCCCCACCTCCTCCACACTGG + Intronic
1168010062 19:53522779-53522801 TCCCACTAATTCCTCCCCAAGGG + Intronic
926101413 2:10120665-10120687 CGCCGCCACCTCCTCCGCAGCGG + Intergenic
928089339 2:28364434-28364456 TCCCACCTCCTCCATTGCAAGGG + Intergenic
928220792 2:29401268-29401290 TCTCACCACCACCTCCACCAAGG - Intronic
928389640 2:30899271-30899293 ACCCACCACCCCCTCACCAATGG + Intergenic
929775836 2:44929933-44929955 TCCCGCCGCCTCCTCAGCCAAGG - Intergenic
930665523 2:54095962-54095984 CCCCCCCACCTCCTCCGGATGGG + Intronic
932413626 2:71561145-71561167 ACCCCCCACCTCCTCTCCAAAGG + Intronic
934774233 2:96927119-96927141 TTCCAGCATCTCCTCCCCAAGGG - Intronic
938599552 2:132822671-132822693 TCACACCAGCTCCCCAGCAATGG + Intronic
940895803 2:159081031-159081053 TCCCACCACATCCTCCTCTCAGG + Intronic
941631514 2:167890486-167890508 TCACACTACCTCATCAGCAATGG - Intergenic
948999624 2:241605538-241605560 TCCCACCACCTGCTCCCCACAGG - Intronic
948999801 2:241606765-241606787 TCCCACCACCTGCACCCCACAGG - Intronic
1170974278 20:21147812-21147834 ACACACCACCTCCTCCACCAGGG - Intronic
1171445076 20:25196961-25196983 TCCCACCGCCTCCTGTGTAAAGG + Intronic
1174710992 20:52705413-52705435 TCCCACCACCCTCTCAGCTAAGG + Intergenic
1175441080 20:58992054-58992076 TCAAACGACCTCCTCCCCAAAGG - Intronic
1175624869 20:60481868-60481890 TCCCCGCACCTCCACCACAATGG + Intergenic
1175808946 20:61847179-61847201 TCCCACCAACTCCCCGGAAAAGG + Intronic
1176167513 20:63681837-63681859 TCCTCCCAACTCCTCCCCAAAGG + Intronic
1176431541 21:6579222-6579244 TCGCTCCACCTCCTCCTCACAGG - Intergenic
1176554029 21:8245316-8245338 TCCCCCCACCCCCTCCCCAGGGG + Intergenic
1176572951 21:8428340-8428362 TCCCCCCACCCCCTCCCCAGGGG + Intergenic
1177178377 21:17720319-17720341 CCCCCCCACCTCCTCCGGACGGG + Intergenic
1178596985 21:33963107-33963129 CACCACCTCCTCCTCAGCAATGG + Intergenic
1178931858 21:36826232-36826254 TCCCACCCCTTCCTCAGCAGTGG + Intronic
1179706935 21:43186684-43186706 TCGCTCCACCTCCTCCTCACAGG - Intergenic
1181500614 22:23313654-23313676 TGCCACCACCCCCTCCCCAGAGG - Intronic
1182121015 22:27786758-27786780 TCCCACCACCTCCTCAGGACAGG - Intronic
1183612978 22:38923063-38923085 TCCTCCCACCTCCTCCTCACAGG - Intergenic
1183828513 22:40406034-40406056 TTCCACCACCTCCTCCCCAGCGG + Intronic
1184381483 22:44147451-44147473 TCCAACCACTTCCCCCGCGACGG - Intronic
1184604461 22:45564199-45564221 TCCCTCCATCTCCTCCACCATGG + Intronic
1203259034 22_KI270733v1_random:162354-162376 TCCCCCCACCCCCTCCCCAGGGG + Intergenic
949542212 3:5041741-5041763 TCACACAAGCTCCTCAGCAATGG - Intergenic
953055873 3:39386839-39386861 TCCGACCAGCTCCTCCTCCAAGG - Intronic
953562535 3:44003814-44003836 TCCCCCCACCCCCTACTCAAGGG - Intergenic
957696699 3:83649188-83649210 TCACACCACCTCTCCAGCAAGGG - Intergenic
959419295 3:106111734-106111756 CCCCCCCACCTCCTCCGGACGGG + Intergenic
959778536 3:110200140-110200162 CCACACCACCTCCCCAGCAAGGG + Intergenic
960340500 3:116469168-116469190 TCCTAACACCAGCTCCGCAAAGG + Intronic
961359866 3:126360370-126360392 TCTCACCACCTCTTCCTCTAAGG + Intergenic
962208355 3:133454586-133454608 TCCCACAACCTCCTCTGCAGAGG + Intronic
962325071 3:134426088-134426110 TCCCACCTCCTCCTGAGCAACGG - Intergenic
963065299 3:141259001-141259023 GCCTACCACCTCCTCCCCAAGGG - Intronic
963180271 3:142348058-142348080 TCCCACCTCCACCTACCCAAGGG - Intronic
964457572 3:156885311-156885333 TCACACCAGCTCCCCAGCAATGG - Intronic
966015339 3:175132440-175132462 CCCCCCCACCTCCTCCGGACGGG + Intronic
966793581 3:183694477-183694499 TCCCACCATCTCCACTGCCAGGG + Intergenic
967805340 3:193710735-193710757 TCCCACCTCCTCCTGCCCACCGG - Intergenic
967847348 3:194054795-194054817 CCCCAGCACCTACTCCACAATGG + Intergenic
968505020 4:967546-967568 TACCAGCACCTCCTCGGCACCGG + Exonic
969129660 4:4982225-4982247 ACCCTCCACCTCCTCCCCTATGG + Intergenic
971227883 4:24771657-24771679 TGCCTCCACCTCCTCCACAGTGG - Intergenic
972501692 4:39683846-39683868 TCCCACCTCATCCTCCTGAATGG + Intergenic
977508897 4:97937415-97937437 TCACAACACCTCTTCAGCAAGGG - Intronic
977536322 4:98260435-98260457 TCCCACCACCACCTCGGCCTCGG - Intergenic
978468330 4:109033020-109033042 TCCCACCAGGTCCTCCATAAAGG + Intronic
980439097 4:132817684-132817706 TCCCACCAGTTCCTCCTCTAGGG - Intergenic
980700325 4:136418904-136418926 TCCCACCATCTCCTCAGCCAAGG + Intergenic
981739042 4:147983821-147983843 TCCCACTAACTCCCCAGCAATGG - Intronic
982070839 4:151693011-151693033 CCCCAGCACCCCCGCCGCAAAGG - Intronic
982178332 4:152727489-152727511 TCCCACCTCCACCTCCCAAAGGG + Intronic
983329164 4:166302171-166302193 TCACACCAGCTCCCCAGCAATGG + Intergenic
983590732 4:169408380-169408402 TCCCCCCACCTACTCCCCCATGG + Intronic
984578544 4:181481270-181481292 TACCATCTCCTCCTCCTCAAAGG + Intergenic
986216293 5:5722263-5722285 TTCCACGACCACCTCCGCAGAGG - Intergenic
990208312 5:53453892-53453914 TTCCCCCACCCCCTCCCCAATGG + Intergenic
997398235 5:133581603-133581625 TCTCAGCACCTACTCCTCAAGGG - Intronic
998351955 5:141507813-141507835 ACCCACCACCTCCACCCCCAGGG - Intronic
999215386 5:149929742-149929764 TCCCACAGCCTCCTCCTGAAAGG - Intronic
1000154732 5:158539320-158539342 TCAGAGCACCTCCTCCCCAAAGG + Intergenic
1000168326 5:158677240-158677262 CCCCGCCACCGCCTCCCCAATGG + Intergenic
1001597545 5:172907728-172907750 TCCCAGCCCCTTCTCCCCAAAGG + Intronic
1002092769 5:176814576-176814598 TCCCACCTCCTCCCCTGCAAAGG + Intronic
1003379444 6:5609990-5610012 TGCTTCCACCTCCTCCGCAGTGG + Intronic
1003907594 6:10716532-10716554 TCCCACCTCATCCTCCTGAATGG + Intergenic
1005066474 6:21822896-21822918 TACCACCACCTCCTCCACTGTGG - Intergenic
1005476926 6:26217065-26217087 GTGCACCGCCTCCTCCGCAAAGG + Exonic
1005483003 6:26272443-26272465 GTGCACCGCCTCCTCCGCAAGGG - Intergenic
1006304088 6:33208520-33208542 TCCCGCCACCGCCGCCGCCATGG - Exonic
1006921333 6:37629476-37629498 TCCCACCAGCTCTTCCCCAGGGG - Intergenic
1008298594 6:49806599-49806621 TCACAGCACCTCTTCAGCAAGGG + Intergenic
1009295512 6:61941526-61941548 ACCCACCACCTCCACCACTAGGG + Intronic
1009876580 6:69513183-69513205 TCACACTAGCTCCTCAGCAATGG + Intergenic
1013507591 6:110815337-110815359 TTCCTCCTCCTCCTCCGCGACGG + Intronic
1014995654 6:128140001-128140023 TTCCATCTCCTCCTCTGCAATGG + Intronic
1015935539 6:138403855-138403877 TCCCACCACCTCCTCCGCAAGGG + Intronic
1016056932 6:139587794-139587816 TCCCACCAGCTAATCCGAAAAGG - Intergenic
1017070258 6:150569891-150569913 TCCCACCACCACCTCTGGATGGG + Intergenic
1018450149 6:163900374-163900396 TCTCACCCCCACCTCCACAAGGG + Intergenic
1020525388 7:9251931-9251953 TCCCAACACCTCTCCAGCAAGGG + Intergenic
1022628729 7:32065077-32065099 TCTCACCACCTCCCCCTCACTGG - Intronic
1025641599 7:63377956-63377978 TCCCACCACCTTCACAGCAATGG + Intergenic
1032935805 7:136729844-136729866 TCACACCACCTCAACAGCAATGG + Intergenic
1033652309 7:143352399-143352421 TCCCATCCCCTCCTCCGACATGG - Intergenic
1033981342 7:147169972-147169994 GCCCACTACCTCCTCAGCAATGG - Intronic
1034206155 7:149317777-149317799 TCCCACCAGCTTCTAAGCAATGG - Intergenic
1036450891 8:8866427-8866449 TCCCACCTCAGCCTCCCCAACGG + Intronic
1037313698 8:17581512-17581534 TCCCACCACCACCACCACATGGG - Intronic
1039455518 8:37703380-37703402 TCCCAGCACTCCCTCCCCAATGG + Intergenic
1044135768 8:88584088-88584110 TCACACCACCTCTCCAGCAAGGG - Intergenic
1044606097 8:94048998-94049020 TCCCCCCACCTCGCCCCCAATGG + Intergenic
1044654182 8:94530384-94530406 TCCCACCTCATCCTCCCCAGTGG - Intronic
1045353709 8:101366022-101366044 ACCCCCCACCTCCTCCCCAAGGG + Intergenic
1046423780 8:114019162-114019184 TAACACCACCTCCTCAGAAAAGG + Intergenic
1047413566 8:124644641-124644663 CCCCACCACGTCCTGCTCAAGGG - Intronic
1047847917 8:128826115-128826137 CCCCCCCACCTCCTCCGGACGGG + Intergenic
1048280749 8:133103968-133103990 TTCCATCGCCTCCTCTGCAATGG - Intronic
1049230546 8:141479206-141479228 TCTCCCCAGCTCCTCCCCAAAGG - Intergenic
1053510707 9:38685809-38685831 TCCCACCCACTGCTCCACAATGG + Intergenic
1054724694 9:68638804-68638826 TCCCACCACCTCCCCAGTGAAGG + Intergenic
1056913429 9:90724680-90724702 TCCCATCACATCCTCCACCATGG - Intergenic
1057055374 9:91956513-91956535 TCCCACAACCTCATCCTCAGTGG + Intergenic
1058625440 9:106928810-106928832 TCCCACCTCCTCCTCAGTGATGG - Exonic
1060340249 9:122768691-122768713 TCACAACACCTCTTCAGCAAGGG + Intergenic
1060542277 9:124438999-124439021 TCCCACCTCCTCCTCCTCTCAGG + Intergenic
1060728927 9:126024936-126024958 CCACACCACCTCCTCCGGGATGG - Intergenic
1061055781 9:128222264-128222286 TTCCTCCACCTCCTTCTCAATGG - Exonic
1061250421 9:129423097-129423119 CCCCACCCCCTCCTCGGCAAAGG - Intergenic
1061774506 9:132952012-132952034 TCCCACCTCCGCCTCCCAAAGGG + Intronic
1061821114 9:133227666-133227688 ACCCACCACCTCCTCCGACTAGG - Intergenic
1062343382 9:136103699-136103721 TCCCGCCACCTCCGCCGCCCTGG - Intergenic
1062360666 9:136186496-136186518 GACCACCACCGCCTCCGCCAGGG + Intergenic
1203475225 Un_GL000220v1:144363-144385 TCCCCCCACCCCCTCCCCAGGGG + Intergenic
1186509423 X:10119312-10119334 TCCCACCACCTTCTCCTTAAGGG + Intronic
1187759007 X:22559059-22559081 TCCCCACACCTCCTCCCCATTGG - Intergenic
1189663147 X:43325547-43325569 TCACACCAGCTCCCCAGCAATGG - Intergenic
1190452886 X:50598425-50598447 GGCCTCCACCTCCTCCCCAAGGG + Exonic
1190777335 X:53563525-53563547 TCCCACCACCTCCCCCACACAGG + Intronic
1192000875 X:67150151-67150173 TCACGCCACCTCTCCCGCAAGGG - Intergenic
1192997936 X:76532436-76532458 TCACAACACCTCTTCAGCAAGGG - Intergenic
1193164211 X:78263381-78263403 TCACAACACCTCCCCAGCAAGGG - Intergenic
1193425367 X:81336186-81336208 TCGCACTACTTCCTCAGCAAGGG - Intergenic
1193626036 X:83820964-83820986 TCACACCATCTCCCCAGCAATGG - Intergenic
1194986624 X:100496827-100496849 TCCCAGCACCTCCTACTCAGAGG - Intergenic
1195198745 X:102525516-102525538 TACCACCACGTCTTCCACAATGG - Intergenic
1197079836 X:122398704-122398726 TCACACTACCTCTTCAGCAATGG + Intergenic
1197541201 X:127764205-127764227 ACTCACCACCTCCTGCCCAATGG + Intergenic
1200392407 X:155957342-155957364 TCCAACCCCCTCTTCCACAATGG - Intergenic
1201063506 Y:10068957-10068979 TAGCACCACCTCCTCCCCGAAGG + Intergenic