ID: 1015935599

View in Genome Browser
Species Human (GRCh38)
Location 6:138404058-138404080
Sequence TGCCGCGGCCCCGCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 5, 3: 36, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015935599_1015935606 29 Left 1015935599 6:138404058-138404080 CCAGCGCGGGCGGGGCCGCGGCA 0: 1
1: 1
2: 5
3: 36
4: 323
Right 1015935606 6:138404110-138404132 GCGCCACCCCCTACTGCCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109
1015935599_1015935602 -7 Left 1015935599 6:138404058-138404080 CCAGCGCGGGCGGGGCCGCGGCA 0: 1
1: 1
2: 5
3: 36
4: 323
Right 1015935602 6:138404074-138404096 CGCGGCAGAGGTTCCCAAACCGG 0: 1
1: 0
2: 1
3: 7
4: 59
1015935599_1015935607 30 Left 1015935599 6:138404058-138404080 CCAGCGCGGGCGGGGCCGCGGCA 0: 1
1: 1
2: 5
3: 36
4: 323
Right 1015935607 6:138404111-138404133 CGCCACCCCCTACTGCCCGCGGG 0: 1
1: 0
2: 1
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015935599 Original CRISPR TGCCGCGGCCCCGCCCGCGC TGG (reversed) Intronic