ID: 1015936135

View in Genome Browser
Species Human (GRCh38)
Location 6:138407490-138407512
Sequence CAGGGCCACTTGAAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015936135_1015936149 23 Left 1015936135 6:138407490-138407512 CCCCAAGGCTTCAAGTGGCCCTG 0: 1
1: 1
2: 2
3: 18
4: 241
Right 1015936149 6:138407536-138407558 CCCACTGCAGCTCTCACAGTTGG 0: 1
1: 0
2: 1
3: 23
4: 221
1015936135_1015936152 27 Left 1015936135 6:138407490-138407512 CCCCAAGGCTTCAAGTGGCCCTG 0: 1
1: 1
2: 2
3: 18
4: 241
Right 1015936152 6:138407540-138407562 CTGCAGCTCTCACAGTTGGAGGG 0: 1
1: 0
2: 0
3: 16
4: 193
1015936135_1015936141 -6 Left 1015936135 6:138407490-138407512 CCCCAAGGCTTCAAGTGGCCCTG 0: 1
1: 1
2: 2
3: 18
4: 241
Right 1015936141 6:138407507-138407529 GCCCTGGCCATGGCTTTGGATGG 0: 1
1: 0
2: 6
3: 53
4: 547
1015936135_1015936140 -10 Left 1015936135 6:138407490-138407512 CCCCAAGGCTTCAAGTGGCCCTG 0: 1
1: 1
2: 2
3: 18
4: 241
Right 1015936140 6:138407503-138407525 AGTGGCCCTGGCCATGGCTTTGG 0: 1
1: 0
2: 0
3: 30
4: 268
1015936135_1015936151 26 Left 1015936135 6:138407490-138407512 CCCCAAGGCTTCAAGTGGCCCTG 0: 1
1: 1
2: 2
3: 18
4: 241
Right 1015936151 6:138407539-138407561 ACTGCAGCTCTCACAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015936135 Original CRISPR CAGGGCCACTTGAAGCCTTG GGG (reversed) Intronic
900458838 1:2790475-2790497 CAGGGCCACCTGGAGACTGGAGG - Intronic
900982884 1:6056633-6056655 TAGGGCCACGTAGAGCCTTGCGG - Intronic
901089854 1:6634051-6634073 CAGCTTCACGTGAAGCCTTGTGG + Intronic
901324023 1:8356373-8356395 CAGGGCCACCTGTAGCCAGGTGG - Intronic
901382821 1:8886221-8886243 CAGGACCACTTGAACCCAGGTGG + Intergenic
903279942 1:22244722-22244744 CTTGGTCACTTGAAGTCTTGTGG + Intergenic
909239253 1:73191495-73191517 CAGGGACACCTGGAGCCTTGTGG + Intergenic
909612215 1:77563391-77563413 CAGGGCCTTTTAAAGCCATGGGG + Intronic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
912693866 1:111825435-111825457 CAGATCCACTTGAAGCTTTAAGG + Intronic
914798981 1:150946107-150946129 GAGGACCACTTGAACCCTGGAGG - Intronic
915139402 1:153757841-153757863 CAGGGCCACTTGACCCCTAAGGG + Intronic
918792490 1:188847006-188847028 CATGGACACTTGAAGGATTGTGG + Intergenic
920501874 1:206490607-206490629 CAGGGCCTCAAGAAGCCATGGGG - Intronic
920964936 1:210693806-210693828 GAGGGGCATTTGCAGCCTTGTGG + Intronic
1063143074 10:3273255-3273277 CAGGACCACTTGAAGCCAGGAGG + Intergenic
1064095063 10:12418032-12418054 GCGGGCCTCTTGAGGCCTTGAGG - Intronic
1066465830 10:35649497-35649519 TAGGGTCATTTGAAGGCTTGAGG + Intergenic
1067917560 10:50417561-50417583 CAGGGGCACGTGCATCCTTGTGG + Intronic
1071585468 10:86816145-86816167 CATGGCCACATGTAGCCTAGTGG - Intronic
1072786837 10:98289418-98289440 CTGGGCCACATGAAGCCTGTGGG - Intergenic
1073081948 10:100865906-100865928 CTGGGGCACTGCAAGCCTTGGGG + Intergenic
1073142958 10:101261167-101261189 CTGGGCCCTTTGAAGCCTTTGGG - Intergenic
1075164093 10:120051498-120051520 CTGGGCAGCTTGAAGGCTTGAGG + Intergenic
1075547568 10:123366751-123366773 CAGTGTCAGATGAAGCCTTGTGG + Intergenic
1076006338 10:126950654-126950676 CAAGGCCACATGATGCCTGGAGG + Intronic
1076270866 10:129150976-129150998 CAGGACAACTTGAAGCATGGGGG - Intergenic
1076351246 10:129816387-129816409 CAGGGCCACTGGATTCCTCGAGG + Intergenic
1077216147 11:1395952-1395974 CAGATCCCCTTGAAGCCTAGAGG - Intronic
1077339487 11:2019641-2019663 GAGGGCCACAGGAAGGCTTGGGG + Intergenic
1077400175 11:2351741-2351763 CAGGACCACCTGGAGACTTGGGG - Intergenic
1078177357 11:8980006-8980028 GAGGATCACTTGAAGCCTGGAGG - Intergenic
1078536637 11:12180114-12180136 CAGGGCCACTAGAGGCCTTGGGG + Intronic
1078573508 11:12479390-12479412 GAGGGTCACTTGAACCCTGGAGG - Intronic
1079967233 11:26994360-26994382 CAGAGCCACATGAAGCCTGCTGG + Exonic
1080492894 11:32785489-32785511 CAGGGTCACTTGAGCCCTGGAGG - Intronic
1083070280 11:59972050-59972072 CAGGATCACTTGAACCCGTGAGG - Intergenic
1083762347 11:64825591-64825613 CCAGGCCACTTGGAGCCCTGGGG - Intronic
1084108540 11:66997523-66997545 CAGGAGCACTTGAAACCTAGGGG + Intergenic
1085022691 11:73219055-73219077 GAGGGCCACTGGCAGCCTTCGGG - Intronic
1086497933 11:87423061-87423083 CAGGGACAAATGAAGCCATGTGG + Intergenic
1088270000 11:108024323-108024345 GAGGGCCACTTGATCACTTGAGG + Intronic
1088633088 11:111793071-111793093 GAGGATCACTTGAACCCTTGAGG - Intronic
1089001765 11:115057905-115057927 TAGGGCCACTCCAATCCTTGGGG + Intergenic
1089032624 11:115348521-115348543 TATGACCACTTGAAGGCTTGCGG + Intronic
1089766607 11:120772078-120772100 CAGGACCACTCAGAGCCTTGTGG + Intronic
1090092989 11:123715849-123715871 AAGGGACACTTGAAGCTTTAGGG - Intergenic
1090404641 11:126469423-126469445 CAGGGCTCCTTGCAGCCCTGGGG + Intronic
1202822472 11_KI270721v1_random:74830-74852 GAGGGCCACAGGAAGGCTTGGGG + Intergenic
1094386078 12:29895552-29895574 TGGGGCCACCTGAGGCCTTGGGG - Intergenic
1098759502 12:74405220-74405242 CAGGGCCAATTAAAGTCCTGAGG + Intergenic
1101221555 12:102646668-102646690 CAGAACCACTTGAAGCCAGGAGG + Intergenic
1101515810 12:105434230-105434252 CAGGGCTGCCTGAGGCCTTGTGG - Intergenic
1101914817 12:108887869-108887891 CAGGGGCACTTGAAACCTTTTGG - Intronic
1102813591 12:115844364-115844386 AAGAGACACTTGAGGCCTTGTGG - Intergenic
1103153857 12:118666483-118666505 AAAGGCCACTTGAAACATTGTGG - Intergenic
1103588100 12:121971139-121971161 CAAGGCCACTTTTAGCCATGTGG - Intronic
1104730177 12:131101070-131101092 CAGGGACACGGGAAGCCCTGAGG - Intronic
1105228123 13:18457268-18457290 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228135 13:18457402-18457424 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228147 13:18457536-18457558 CTGGGCCACATGAAGCCTGTAGG + Intergenic
1105228159 13:18457670-18457692 CTGGGCCACATGAAGCCTGTAGG + Intergenic
1105228171 13:18457804-18457826 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228183 13:18457938-18457960 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105557202 13:21458836-21458858 CTGGGGCTCCTGAAGCCTTGCGG - Intronic
1109762211 13:66845101-66845123 CAGGGCGGCTTGAAGGCTGGGGG - Intronic
1112190228 13:97169848-97169870 AAGGGCCACATCAAGCATTGTGG - Intergenic
1113618216 13:111695825-111695847 CAGGACCACTGGCAGCCGTGTGG - Intergenic
1113623747 13:111781086-111781108 CAGGACCACTGGCAGCCGTGTGG - Intergenic
1114522645 14:23348628-23348650 CAGGGCCACCCGAAGCCTCTGGG + Exonic
1114625130 14:24123874-24123896 AGGGGCCACATGAAGCCTTGTGG - Exonic
1114694788 14:24616559-24616581 AGGGGCAACTTGAAGCCTGGAGG + Intergenic
1117651730 14:57914772-57914794 CAGGGCTACTTGAGACCTTGAGG - Intronic
1117808522 14:59520019-59520041 CAGGGCAACTTGAAGGCTGAGGG - Intronic
1118511750 14:66482770-66482792 CAGAGCCAATTCAACCCTTGGGG - Intergenic
1119560959 14:75589450-75589472 CAGGGCTGCCTGAGGCCTTGGGG - Intronic
1121874593 14:97439896-97439918 CAGGGGCGCTTTAGGCCTTGGGG + Intergenic
1121974884 14:98393764-98393786 CAGGGCCAGCTGGAACCTTGGGG + Intergenic
1122053379 14:99075299-99075321 CATGGCCACAGGAAGGCTTGTGG - Intergenic
1122803970 14:104247490-104247512 GGGGGCCACACGAAGCCTTGGGG + Intergenic
1124025460 15:25961537-25961559 CAGTGCCAATTCATGCCTTGTGG + Intergenic
1124345904 15:28921392-28921414 AAGGTTCACTTGAAGACTTGGGG + Intronic
1124483941 15:30099966-30099988 CAGGGCCACCTCTCGCCTTGGGG + Intergenic
1124519639 15:30397258-30397280 CAGGGCCACCTCTCGCCTTGGGG - Intergenic
1124680421 15:31725666-31725688 CAGAGCCACGTGTAGCTTTGGGG - Intronic
1124759636 15:32438609-32438631 CAGGGCCACCTCTCGCCTTGGGG - Intergenic
1129403633 15:75300587-75300609 CAGGGCCACCTCTCGCCTTGGGG + Intergenic
1131390010 15:92040035-92040057 CAGGGCCAGTTGGAGGCTTGGGG + Intronic
1132238283 15:100238142-100238164 CAGGGCCATTAGAAGTGTTGAGG - Intronic
1132769354 16:1552305-1552327 CAGGGACAGTGGGAGCCTTGGGG - Intronic
1132802085 16:1759458-1759480 CAGGTCCACTTGGGGCCTCGTGG + Intronic
1135565439 16:23508154-23508176 GAGGATCACTTGAACCCTTGGGG - Intronic
1137042335 16:35624552-35624574 CAGGTCCAGATGAAGCCATGGGG + Intergenic
1137742365 16:50792405-50792427 ATGAGCCACTTGAAGACTTGTGG + Intronic
1138215307 16:55199569-55199591 TAGGGCTACCTGAGGCCTTGGGG + Intergenic
1138540338 16:57683964-57683986 CAGGGCCACGTGGATCTTTGGGG - Exonic
1140023761 16:71264431-71264453 CAGGACCACTTAGAGCCTTGGGG - Intergenic
1140034525 16:71362079-71362101 CAGGGCCACTCGGAGCATGGAGG - Intronic
1140378463 16:74464482-74464504 CTGTGACACTTGAAGACTTGCGG - Intronic
1140855673 16:78975730-78975752 CAGAGCCAATTGAGGCCTTTGGG + Intronic
1142016263 16:87749671-87749693 GAGGGTCACTTGAAACCATGAGG - Intronic
1144713571 17:17419283-17419305 CAGTGGGATTTGAAGCCTTGTGG + Intergenic
1145757947 17:27406451-27406473 GAGGATCACTTGAGGCCTTGGGG + Intergenic
1146683979 17:34828014-34828036 CAGTGGCACCTGAAGCCATGAGG - Intergenic
1149440125 17:56666930-56666952 CTGGGAAACTTGAAGCCATGTGG + Intergenic
1150603679 17:66673447-66673469 CAGGGCCATATGAAGCTGTGAGG + Intronic
1151377838 17:73703438-73703460 CAGGGCCTCTGGAAGCACTGGGG + Intergenic
1152378477 17:79930387-79930409 CCGGCCCACCTGAGGCCTTGGGG - Intergenic
1153608960 18:6862359-6862381 CGGGGCCCCCTGAAGTCTTGGGG - Intronic
1154267681 18:12893360-12893382 CAGGGCCCCTGGACTCCTTGGGG - Intronic
1154525269 18:15282342-15282364 CTGGGCCACATGAAGCCTGTAGG - Intergenic
1157187604 18:45553747-45553769 TAGGGCCAACTGAAGCCTTATGG - Intronic
1159285113 18:66338506-66338528 CAGGGCAACACCAAGCCTTGAGG + Intergenic
1160222361 18:76986410-76986432 CAGGTGCTCTGGAAGCCTTGAGG - Intronic
1161177820 19:2858098-2858120 GAGGATCACTTGAGGCCTTGAGG + Exonic
1161305176 19:3563538-3563560 GAGGACCACTTGAAGCCAGGTGG - Intronic
1163103063 19:15109147-15109169 CAGGGCTCCTTGATGCCTCGGGG - Exonic
1163475504 19:17523693-17523715 AGGGGCCACGTGGAGCCTTGTGG - Intronic
1163510745 19:17733646-17733668 CAGGGCCTCGTGAAGCCTCATGG + Intronic
1167602864 19:50464810-50464832 CAGGTACACTGGAGGCCTTGGGG - Intronic
1168664363 19:58192189-58192211 GAGGGCCACTTCGAGCCTAGTGG + Intronic
1168724097 19:58571204-58571226 CAGGGCCTCTTGGGGCCCTGTGG + Exonic
924975398 2:169498-169520 CAGGTGCACTTGGAGCCATGTGG - Intergenic
925057304 2:865048-865070 CAGGGCCACCTGGTGGCTTGGGG - Intergenic
925801845 2:7609509-7609531 CTGGGCAAGTGGAAGCCTTGTGG + Intergenic
926173130 2:10566265-10566287 CGGGGCCACGTGGTGCCTTGTGG + Intergenic
926633595 2:15158749-15158771 CATGGCCACCTGGAGCCCTGGGG - Intergenic
927295888 2:21452777-21452799 CAAGGCCACAAGAAGCATTGTGG - Intergenic
927671563 2:25072777-25072799 CAGAGCTTCTTGCAGCCTTGGGG + Intronic
928399320 2:30966450-30966472 TAGGGCCAGGTGAAGCCGTGGGG - Intronic
928606436 2:32947888-32947910 CAGGGCCACTCGGAGCCCCGCGG + Intronic
929055692 2:37874466-37874488 CAAGGCCACCTGAAGACCTGAGG + Intergenic
931230519 2:60370847-60370869 CAGTGGCATTTGAAGCCTAGAGG + Intergenic
932435915 2:71702502-71702524 CAGCTCCTCTGGAAGCCTTGAGG + Intergenic
932471512 2:71962475-71962497 CTGGGCCAGCTGAAGCCATGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934535946 2:95133496-95133518 AAGGGCAACATGAATCCTTGTGG + Intronic
936065541 2:109329375-109329397 CAGGTCCACTTGATTCTTTGGGG - Intronic
938524454 2:132114467-132114489 CTGGGCCACATGAAGCCTGTAGG - Intergenic
940855754 2:158727472-158727494 AAGGGCCATTAGAGGCCTTGGGG + Intergenic
946007163 2:216535353-216535375 CAGGGGCACTTGAAGCCAGTGGG - Intronic
946434948 2:219645119-219645141 CAGGCCCACTTCAGGCCCTGAGG + Intergenic
947162768 2:227230796-227230818 CAGGGGCACTTGAATACTTTTGG - Intronic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
948412118 2:237771739-237771761 AAGGGCCACTTGGAGCCTTCTGG - Intronic
948919257 2:241053684-241053706 CCTGGCCCCTTGAAGACTTGTGG + Intronic
1171108898 20:22462496-22462518 CAGGGCCAATGGAAGCCCAGTGG + Intergenic
1172196438 20:33095062-33095084 AAGGGCCACGTGAATCCTGGAGG - Intronic
1173012695 20:39196510-39196532 GAGGGCTGCTTGAATCCTTGTGG + Intergenic
1174584200 20:51594779-51594801 CAGGGTGACATGAAGCCCTGTGG - Intergenic
1175746683 20:61461891-61461913 CAGGGCCACATGAAGCCCAGTGG + Intronic
1176141321 20:63546331-63546353 CAGGGCCACTTCCAGCCTCCTGG - Intronic
1176772159 21:13086130-13086152 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1177481269 21:21692667-21692689 GAGGGTCACTTGAACCCTGGAGG - Intergenic
1178592529 21:33923633-33923655 CAGAGCCACTTGTTGTCTTGGGG + Intergenic
1179370496 21:40802130-40802152 CAGGACTGCTTGAGGCCTTGGGG + Intronic
1180013337 21:45065555-45065577 CAGGGCCAGGTGGAGCCCTGAGG + Intergenic
1181906472 22:26201027-26201049 CAGGCCTTCTTGAAGCCTTATGG + Intronic
1182327965 22:29528533-29528555 CAGGGCCCCTTTATGCCATGTGG - Intronic
1182419026 22:30239757-30239779 CAGGGGCACTTGAAGTGTTTAGG - Intergenic
1183392184 22:37552061-37552083 CAGGGCCACGTGAAGCCCCCAGG + Intergenic
1184942523 22:47779604-47779626 CAGGGGCTCTTGAAGCCTCTCGG - Intergenic
950319280 3:12035235-12035257 CAGGGCTGCTTGAGGCCTTGTGG - Intronic
950832381 3:15887595-15887617 CAGGGCCACTTGGAGCCTTGGGG + Intergenic
950853941 3:16088171-16088193 CAGGGCCCCCTTAAGACTTGTGG + Intergenic
951300813 3:20994430-20994452 CAGGGCCACTGCATGTCTTGAGG + Intergenic
953166870 3:40473032-40473054 CAGGGTCACTTGAACCCAGGAGG - Intergenic
954671415 3:52293202-52293224 CAGGGCCTCTCTAAGCCTTAGGG + Exonic
955726828 3:61942067-61942089 GAGAGTCACTTGAACCCTTGTGG + Intronic
955901178 3:63757050-63757072 CAGAGTCACTTGAAGATTTGGGG + Intergenic
955954059 3:64270079-64270101 CAGGGCCACATTGAGCCATGAGG + Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
957167004 3:76687567-76687589 CAGGGGCTGTTGAAGCCTAGAGG - Intronic
959509055 3:107189325-107189347 CAGTGCTACATGGAGCCTTGGGG - Intergenic
962048904 3:131791858-131791880 CACGGCCACTTGGTGCCTTGGGG + Intronic
962384629 3:134922901-134922923 CAGGGGCAACTGAATCCTTGTGG - Intronic
964728397 3:159839062-159839084 CAGGGCCACTTCAGGACTTGAGG - Intronic
966395521 3:179498919-179498941 CAGGGCCTGTTGAAGAGTTGGGG - Intergenic
966744742 3:183264760-183264782 CAGGGAAACTTGTAGCCTTTGGG + Intronic
967575644 3:191088323-191088345 CAGAGCCACTGGAGGCCTCGAGG - Intergenic
968545022 4:1194061-1194083 CAAGGCCACTTCAAAGCTTGTGG - Intronic
969439556 4:7209044-7209066 CAGGGCCACATGAAGCCAGGAGG - Intronic
970221348 4:13815199-13815221 CTGGGCCACATGCAGCCCTGTGG + Intergenic
970440294 4:16075956-16075978 CAGAGCTTCTGGAAGCCTTGGGG + Exonic
971870158 4:32225066-32225088 CAGGGCCGCTTGAACCCAGGAGG - Intergenic
974927757 4:68322090-68322112 CAGGGCCACTTGATCCCCTTTGG + Intronic
975969124 4:80012728-80012750 AAGGGATACTTGAAGCCTGGAGG - Intronic
977054528 4:92174694-92174716 CAGTGCCTCTTGATGCCATGGGG + Intergenic
977625176 4:99182077-99182099 CAGGGCCTGTTGAAGAGTTGGGG - Intergenic
977651350 4:99473169-99473191 CAGGGCTGCCTGAAGCCTTTGGG - Intergenic
982105611 4:152009374-152009396 CAGGCCCACAGGAAGCCTGGAGG - Intergenic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
985252327 4:188036392-188036414 GAGGGTCACTTGAACCCTGGAGG + Intergenic
985884742 5:2668821-2668843 CAGGGCCTCTGGGAGCCTGGGGG - Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
986291222 5:6400639-6400661 GAGGGCAACTTGCATCCTTGGGG + Intergenic
986679463 5:10220343-10220365 CAGGGCCACCTGAATCCTTTCGG - Intergenic
986699111 5:10388196-10388218 GAGGACCACTGGAAGCCTAGTGG + Intronic
987061951 5:14251543-14251565 CACAGCCACCTGCAGCCTTGGGG + Intronic
988077745 5:26373999-26374021 CAGGGCTGCCTGAGGCCTTGAGG + Intergenic
991017860 5:61950493-61950515 CAGGGCAGCTTGAAGGCCTGTGG - Intergenic
993107191 5:83612582-83612604 CAGGGCCACCTAGAGCCTTGAGG + Intergenic
993340183 5:86716143-86716165 CAGGTCCTTTTGAAGCCTTTTGG - Intergenic
994517352 5:100787376-100787398 CAGGGCCACTTGGAGGGTTGGGG + Intergenic
1002100846 5:176856823-176856845 CAGGGCCACAGGAAGCCTTGGGG - Intronic
1005932507 6:30493991-30494013 CGGGGCTACCTGAGGCCTTGGGG + Exonic
1006812758 6:36830692-36830714 CAGGGCCACATGTCGCCATGTGG - Intronic
1007672533 6:43567844-43567866 AAGGCTCACTTGAAGCCTGGAGG + Intronic
1012334528 6:98038689-98038711 CAGGGTAACTTCAGGCCTTGGGG - Intergenic
1012494029 6:99814371-99814393 CAGTGGCAGTTGATGCCTTGGGG + Intergenic
1014770707 6:125454924-125454946 CAGGGCCAGTTGATGTTTTGGGG - Intergenic
1015936135 6:138407490-138407512 CAGGGCCACTTGAAGCCTTGGGG - Intronic
1018380447 6:163253967-163253989 CAAGCTCACTGGAAGCCTTGGGG + Intronic
1018548349 6:164963062-164963084 CAGGGCTGCCTGAAGCCCTGGGG + Intergenic
1018576454 6:165264751-165264773 TAGGGAGACTTGAAGCATTGAGG + Intergenic
1019287372 7:230393-230415 CAGGGGCACTTTAAGCCACGGGG - Intronic
1020618134 7:10485543-10485565 CCAGGTCACTTGTAGCCTTGAGG - Intergenic
1022046137 7:26624068-26624090 CATGGCCGCTTATAGCCTTGTGG + Intergenic
1022514034 7:30964184-30964206 CAGGGCCAACTGGAGCCTGGCGG + Intronic
1022519355 7:30995936-30995958 CAGGGAGACAGGAAGCCTTGTGG + Intergenic
1023561494 7:41477996-41478018 CAGGGCCACTTAAAACTGTGTGG + Intergenic
1023624267 7:42100650-42100672 CAGGATCACTTGAAGCCAGGGGG + Intronic
1024604421 7:51012575-51012597 GAGGGCCACCCGCAGCCTTGGGG - Intergenic
1029101953 7:98138379-98138401 CAGCGCTACTAGAAGGCTTGGGG - Intronic
1029493028 7:100882485-100882507 CAGAGCCACTTGGCCCCTTGGGG + Intronic
1029952697 7:104603865-104603887 CAGGGCTGCCTGAGGCCTTGGGG - Intronic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1035749597 8:1987089-1987111 CAGAGACACTGGAAGCCCTGTGG + Intronic
1040124961 8:43726734-43726756 CAGGGCCCATTGAAGCCTTTGGG + Intergenic
1048295878 8:133212930-133212952 CATGGCCACTTGCAGAATTGGGG - Exonic
1048892591 8:138961176-138961198 CTTGGCCACTTGAAACCTAGAGG - Intergenic
1049248327 8:141574766-141574788 CTGGGTTATTTGAAGCCTTGTGG - Intergenic
1049764312 8:144346621-144346643 CAGGGTCACTTGAACCCAAGAGG - Intergenic
1050057585 9:1671971-1671993 CAGGGCTGCCTGAGGCCTTGAGG - Intergenic
1052799532 9:32955495-32955517 CAGCCCCACTAGAAGCTTTGAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056329448 9:85509710-85509732 CTGGGCCACATGAAGGCTTTGGG - Intergenic
1057527310 9:95814333-95814355 CAGAGCCACTTGAAGGCATTGGG - Intergenic
1058146290 9:101415460-101415482 CAAGGAGACTTGAAGACTTGAGG + Intergenic
1059785544 9:117578755-117578777 CAGGGCTCCCTGGAGCCTTGAGG + Intergenic
1061009855 9:127948470-127948492 CAGGGCCCCCTGCAGCCTTTCGG + Intronic
1061525895 9:131161925-131161947 CTGGGCCACATGAAGCCTGCAGG - Intronic
1061866108 9:133492519-133492541 CTGGGCCACCTGCAGCCCTGGGG - Intergenic
1062105858 9:134754416-134754438 CTGGGCCACATGAAGCCAGGTGG + Intronic
1062390313 9:136331241-136331263 CAGGGCCACGTGGGGCCTGGGGG - Intronic
1062512754 9:136916544-136916566 CAGGACCACGTCAAGACTTGTGG + Exonic
1187421002 X:19133642-19133664 GAGGGCCACTTGGAGTATTGAGG - Intergenic
1188336788 X:28945587-28945609 CAGGGCCAGTTGGAGGGTTGGGG + Intronic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1190073238 X:47296000-47296022 CAGGATCACTTGAATCCTGGAGG - Intergenic
1190269377 X:48850924-48850946 CGGGGCTACCTGAAGCCTTGGGG + Intergenic
1191593042 X:62910402-62910424 TAGGGTCACTTGAACCCTGGAGG + Intergenic
1193530236 X:82647155-82647177 CAGGGCAACTTGAAGCAAGGAGG + Intergenic
1194985438 X:100485142-100485164 GAGGGCCATTTGAAGGCTTTTGG - Intergenic
1196723434 X:118875696-118875718 CAGGGCTGCCTGAGGCCTTGGGG + Intergenic
1197342432 X:125289108-125289130 CAGGGCTGCCAGAAGCCTTGGGG + Intergenic
1201895193 Y:18985402-18985424 CATGTCCAGTTGGAGCCTTGGGG - Intergenic